جستجوی مولکولی تریپانوزوم در شترهای یک‌کوهانه کشتار شده در کشتارگاه نجف‌آباد

نویسندگان

1 دکتری دامپزشکی، دانشگاه شهرکرد، ایران

2 دانشیار میکروبیولوژی، دانشگاه شهرکرد، ایران،

3 دانشیار میکروبیولوژی، دانشگاه اصفهان، ایران،

4 دکتری دامپزشکی، دانشگاه شهرکرد، ایران،

5 کارشناس ارشد میکروب‏شناسی، دانشگاه اصفهان، ایران

6 دانشجوی دکتری دامپزشکی، دانشگاه شهرکرد، ایران

چکیده

  مقدمه : تریپانوزوم‌ها حیوانات متعددی را آلوده کرده و تب، ضعف و رخوت ایجاد می‏کنند که به کاهش وزن و آنمی منجر می‌شود. اگر بیماری در دام‌ها درمان نشود می‌تواند به مرگ و زیان‏های جدی اقتصادی منتهی شود. مطالعه‌ حاضر به منظور ردیابی مولکولی تریپانوزوما در شترهای یک‌کوهانه کشتار شده در کشتارگاه نجف‌آباد انجام شد‏‏.   مواد و روش‏‏ها: تعداد 278 نمونه خون در سه بازه زمانی مختلف از شترهای یک‌کوهانه کشتار شده در کشتارگاه نجف‌آباد اخذ و برای ردیابی تریپانوزوما به روش PCR آزمون شدند.   نتایج: میزان آلودگی به تریپانوزما در کل 07/1 درصد بود. نمونه‌های مثبت تنها در فصل‌های بهار و تابستان یافت شدند (8/3 درصد). در فصل‌های پاییز و زمستان هیچ نمونه‌ی مثبتی به دست نیامد.   بحث و نتیجه‏گیری: نتیجه‌ حاضر می‌تواند بیانگر این مسئله باشد که خوشبختانه عفونت با تریپانوزوم در منطقه مورد مطالعه از شیوع بسیار پایینی برخوردار است. برای پیشگیری از بیماری پیشنهاد می‌شود از ورود دام‌های مشکوک به بیماری به کشور ممانعت شود. اگر امکان آزمایش دام‌های وارداتی که از نظر ظاهری سالم هستند به وسیله‌ آزمون‌های مولکولی وجود ندارد، توصیه می‌شود به وسیله‌ی آزمون‌های سریع و ساده‌ای مانند آگلوتینیشن آزمون که برای انجام آن نیاز به متخصص نیست ارزیابی شوند.  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Molecular detection of Trypanosoma from one-humped camels slaughtered in Najafabad slaughterhouse

نویسندگان [English]

  • Samaneh Mehrabiyan 1
  • Mohammadreza Mahzounieh 2
  • Mohammad Rabbani Khoorasgani 3
  • Hossein Tahmasby 1
  • Jasem Amiri Dehcheshmeh 4
  • Azam Ghorbani 5
  • Hamid Esmaili Najafabadi 1
  • Mehdi Salimi 6
1 DVM, University of Shahrekord, Iran
2 Associate Professor of Microbiology, Research Institute of Zoonotic Diseases, Shahrekord University, Iran
3 Associate Professor of Microbiology, University of Isfahan, Isfahan, Iran
4 DVM, University of Shahrekord, Iran
5 M.Sc. of Microbiology, University of Isfahan, Iran
6 DVM Student, University of Shahrekord, Iran
چکیده [English]

  Introduction: Trypanosomes infect a variety of animals and cause fever, weakness, and lethargy, which lead to weight loss and anemia. In livestock the disease is fatal unless treated and causes serious economic losses. Present study was conducted to detection of Trypanosoma from one-humped camels slaughtered in Najafabad slaughterhouse .   Materials and methods: 278 blood samples were taken at three different time periods from one-humped camels slaughtered in Najafabad slaughterhouse and were tested by polymerase chain reaction (PCR) to detection of Trypanosoma .   Results: The overall infection rate of Trypanosoma was 1.07%. Positive samples (3.8%) only found in spring and summer, and no positive sample was found in fall and winter .   Discussion and conclusion : Fortunately, this may suggest that the prevalence of Trypanosoma is very low in the region. It is suggested to prevent the disease by preventing livestock suspected of carrying the disease from entering the country. If it is not possible to test imported healthy livestock by molecular assays, it is recommended that simple and rapid tests such as agglutination tests that do not need an expert be assessed .

کلیدواژه‌ها [English]

  • Trypanosoma
  • Camel
  • PCR

مقدمه

تریپانوزوم‏ها با آلودگی خون میزبانان مهره‏دار موجب بروز تب، ضعف و رخوت، کاهش وزن و کم‌خونی می‌شوند. در صورت عدم درمان، در برخی از حیوانات به مرگ منجر می‌شوند و می‏توانند زیان‏های جدی اقتصادی ایجاد نمایند. تب به شکل دوره‌ای یکی از علائم این بیماری است. البته گاهی اوقات نیز وضعیت بیماری در حیوان چنان حاد است که بدون ظهور تب حیوان تلف می‏شود (1). شروع کم‏خونی در ارتباط نزدیک با وجود انگل در خون است (2).

انگل تریپانوزوم شامل چندین گونه است که حیوانات وحشی و اهلی به خصوص حیوانات سم‌دار و همچنین، انسان را آلوده می‏کند. تریپانوزوم‌های آفریقایی مثل تریپانوزوما رودزینس[1]، تریپانوزوما گامبینس[2]، تریپانوزوما بروسئی[3]، تریپانوزوما کونگولنس[4]، تریپانوزوما ویواکس[5]و تریپانوزوما سویس[6] همگی از طریق پشه‌های تسه‌تسه (گونه‌های گلوسینا[7]) منتقل می‌شوند. گونه‌های ایجاد کننده‌ تریپانوزومیازیس[8] آفریقایی انسانی (بیماری خواب)، می‌توانند حیوانات وحشی را نیز آلوده کنند و امکان انتقال از این حیوانات به انسان (بروز بیماری مشترک) وجود دارد. اما تریپانوزوم‌های اسب[9] و شتر[10] به وسیله پشه‌های تسه‌تسه منتقل نمی‌شوند ولی از طریق تماس مستقیم با خون از قبیل آمیزش (اسب) یا حشرات گزنده مثل مگس‏های اسبی (متعلّق به خانواده تابانیده) منتقل می‌شوند. تریپانوزوما اکویی پردوم به طور اختصاصی باعث ایجاد بیماری دورین در اسب‌ها و تریپانوزوما اوانسی باعث ایجاد بیماری سورا به خصوص در چهارپایان و همچنین، در پستانداران دیگر مثل انسان می‌شود (3 و 4).

به علت پایداری این بیماری، ساخت واکسن برای آن بسیار مشکل شده است. همچنین، بیماری در بسیاری از حیوانات که درمان می‌شوند، برگشت‌پذیر است (5). در حال حاضر در پروتکلی که توسط سازمان جهانی بهداشت حیوانات برای این بیماری مطرح شده است توصیه می‌شود حیوانات سرم مثبت، معدوم شوند. مسئله‌ عدم درمان یا وجود واکسن به‏ویژه در کشورهای در حال توسعه که از دام‌ها برای کشاورزی و حمل و نقل استفاده می‌شود از اهمیت ویژه‌ای برخوردار است (6).

اگرچه علائم بیماری در مراحل پیشرفته، ممکن است پاتوگنومونیک[11] باشد اما بیماری به‏ویژه در مراحل ابتدایی یا در دوره کمون معمولا با اطمینان قابل شناسایی نیست. آزمون‌های مولکولی برای تشخیص دقیق بسیاری از میکروارگانیسم‌ها به کار گرفته شده و در نتایج آزمون‌های مولکولی خطای کمتری وجود دارد. طبق اظهارات سازمان جهانی بهداشت حیوانات، استاندارد طلایی[12] برای تشخیص آلودگی به تریپانوزوم، روش PCR است و خطای آزمون‌های سرولوژی و لام خونی در مقایسه با روش PCR بالاست (7). برای مثال‏ طی مطالعه‌ای برای بررسی مقایسه‌ای دقت آزمون‌های مختلف، 217 شتر بررسی شدند. میزان آلودگی به تریپانوزوما اوانسی در آزمون‌های PCR، Ag-ELISA، thin blood smear (TBS) و wet blood film (WBF) به ترتیب 05/17، 67/9، 60/4 و 14/4 درصد اعلام شد (8).

مطالعات گسترده‏ای که در زمینه بررسی آلودگی شترهای مناطق مختلف از نظر آلودگی به تریپانوزوم در نقاط مختلف دنیا انجام شده است، نشان دهنده‌ وضعیت متفاوت آلودگی به تریپانوزوم از مقادیر پایین تا بالا در مناطق مختلف بوده است. در مطالعاتی نیز که طی سال‌های اخیر در ایران انجام شده است، میزان آلودگی به تریپانوزوم در شتر از 38/0 تا 47/19 درصد در نقاط مختلف گزارش شده است (9- 15).

اگرچه در ایران گزارش‏هایی از آلودگی شتر به تریپانوزوم وجود دارد، اما از آنجایی که در ایران، در مورد ردیابی تریپانوزوم در شتر مطالعه‌ای به روش مولکولی که خطای کمتری در آن وجود دارد انجام نشده، مطالعه‌ حاضر برای جستجوی مولکولی جنس تریپانوزوم در شترهای یک‌کوهانه کشتار شده در کشتارگاه نجف‌آباد که از نظر ظاهری سالم بودند انجام شد.

 

مواد و روش‏ها

در این مطالعه، 278 نمونه خون از شترهای یک‌کوهانه کشتار شده در کشتارگاه نجف‌آباد در چند بازه زمانی مختلف جمع آوری شد (جدول1).

 برای استخراج DNA از کیت استخراج DNA از خون، محصول شرکت سیناژن استفاده شد. نمونه‏های DNA در فریزر با دمای منفی 70 درجه سانتی‏گراد تا زمان انجام آزمایش نگهداری شدند. برای ردیابی جنس تریپانوزوم با روش PCR از پرایمر‌های توصیف شده توسط گیسن[13] و همکاران (ساخت سیناژن، ایران)،
 18 ST nF2 (CAACGATGACACCCATGAATTGGGGA)
و 18 ST nR3 (TGCGCGACCAATAATTGCAATAC)
استفاده شد (16). واکنش PCR با استفاده از مواد تهیه شده از شرکت سیناژن در حجم 25 میکرولیتر (5/2 میکرولیتر بافر10X PCR ، 5/1 میکرولیتر MgCl2 50 میلی مولار، 5/0 میکرولیترdNTP  10 میلی مولار، 5/1 واحد آنزیم Taq پلی مراز، 1 میکرولیتر با غلظت 10 میکرومولار از هر پرایمر، 2 میکرولیتر DNA الگو) انجام شد. برنامه دمایی مورد استفاده به ترتیب واسرشت ابتدایی در 94 درجه سانتی‏گراد به مدت 5 دقیقه و 40 سیکل از قرار 94 درجه به مدت 60 ثانیه، 58 درجه به مدت 60 ثانیه، 72 درجه به مدت 60 ثانیه و گسترش نهایی در 72 درجه به مدت 5 دقیقه در دستگاه ترموسایکلر (اپلاید بایوسیستم[14]، ساخت آمریکا) انجام شد. در پایان محصولات PCR روی ژل آگاروز 5/1 درصد (ساخت سیناژن، ایران) الکتروفورز (ساخت پایاپژوهش پارس، ایران) شدند.

 

نتایج

تنها در میان نمونه‌هایی که در فصل‌های بهار و تابستان اخذ شده بود نمونه مثبت یافت شد و در نمونه‌هایی که در فصل‌های پاییز و زمستان اخذ شده بود هیچ نمونه‌ی مثبتی به دست نیامد. میزان آلودگی به تریپانوزم در فصل‌های بهار و تابستان و در کل به ترتیب 8/3 و 07/1 درصد بود (جدول1).

 

 

جدول1- زمان نمونه‌گیری و تعداد نمونه‌های مورد بررسی

مرحله نمونه‌گیری

فصل

سال نمونه‏گیری

تعداد نمونه

موارد مثبت

1

بهار و تابستان

1388

78

3 (8/3 درصد )

2

زمستان

1390

100

صفر

3

پاییز

1391

100

صفر

کل

-

-

278

3 (07/1 درصد )

 

 

 

شکل1-تصویر الکتروفورز ژل آگاروز جنس تریپانوزوم.
M: نشانگر100 جفت بازی پلاس؛ 5 و 6: کنترل منفی؛
4: کنترل مثبت تریپانوزوم؛ 3-1: نمونه‌های مثبت جنس تریپانوزوم

 

بحث و نتیجه‏گیری

از نتایج مطالعاتی که در زمینه‌ کسب اطلاع بیشتر و دقیق‌تر از وضعیت انتشار و تعیین میزان بیماری در جمعیت‌های دامی انجام می‌شوند، برای شناسایی فاکتورهای ایجاد کننده بیماری، درمان، کنترل بهینه بیماری‌ها و حل مشکلات بهداشتی استفاده می شود. از آنجایی که یک منطقه با منطقه‌ دیگر از نظر وضعیت انتشار، نوع و میزان فاکتورهای ایجاد کننده بیماری ممکن است متفاوت باشد، لازم و ضروری است که چنین مطالعاتی در هر منطقه‌ای به شکل جداگانه و چند وقت یکبار تکرار شوند.

در مطالعات انجام شده گزارش‏های مختلفی وجود دارد که از میزان آلودگی به تریپانوزوم در شترهای مناطق مختلف از مقادیر پایین تا درصد‌های بالا در نقاط مختلف حکایت می‏کنند. در تعدادی از مطالعات مشابه با مطالعه‌ی حاضر، میزان پایینی از آلودگی گزارش شده است. در یک مطالعه به منظور بررسی میزان شیوع انگل‏های خونی در شتران کشتاری شهرستان مشهد، از نمونه‌های اخذ شده در لوله‏های آزمایش حاوی ماده ضد انعقاد EDTA، گسترش تهیه و به روش گیمسا رنگ‏آمیزی شد. نتایج نشان داد 38/0 درصد آلودگی به تریپانوزوما اوانسی وجود داشت (9). طی مطالعه‏ای که در شترهای یزد (2012) انجام شد با روش رنگ آمیزی گیمسا، 4 نمونه آلوده به تریپانوزم اوانسی در بین 117 نمونه (4/3 درصد) تشخیص داده شد. این 4 جدایه از نظر برخی از ویژگی‏های ژنتیکی نیز بررسی شدند (10). در یک بررسی که در کشتارگاهی در مصر (2011) انجام شد، 7/4 درصد از شترهای مورد بررسی آلوده به تریپانوزوما اوانسی بودند (11). در بررسی نمونه‏های خون شتر در سومالی، 33/5 درصد آلوده به تریپانوزوما اوانسی، 03/0 درصد آلوده به تریپانوزوما کونگولنس و 03/0 درصد آلوده به تریپانوزوما بروسه‌ای بودند (12). در تحقیقی که در سودان در منطقه اومشادیا[15] انجام شد میزان آلودگی 6 درصد گزارش شد (13).

در تعدادی از مطالعات دیگر میزان کمابیش بالایی از آلودگی گزارش شده است. در یک بررسی در نقاط مختلف شهرستان زابل، 113 نمونه‌ی خونی بررسی شدند. نتایج نشان داد که 47/19 درصد از شترهای مورد مطالعه آلوده به تریپانوزوما اوانسی بودند (14). نتایج مطالعه‏ای روی 333 نمونه خون شتر متعلّق به مناطق مختلف شهرستان بوشهر، نشان داد، 32 نمونه (4/10 درصد) خون آلوده به تریپانوزوما اوانسی بودند (15). طی مطالعه‌ای در سودان در منطقه‌ی بوتانا پلاینز[16] 1/57 درصد آلودگی با تریپانوزوم گزارش شد (16).

اگرچه نتایج این مطالعه نشان داد که شترهای نجف‌آباد، با انگل تریپانوزوم می‌توانند آلوده شوند اما با توجه به میزان پایین آلودگی به تریپانوزوم، به نظر می‏رسد که این عامل عفونی حضور چشمگیری در منطقه مورد بررسی ندارد. از نظر میزان آلودگی، این مطالعه با چندین مطالعه‌ی انجام شده در کشور (9 و 10) و برخی از مطالعات خارجی (11-13) تشابه دارد.

همانطور که ذکر شد بسیاری از حشرات در انتقال تریپانوزوم نقش دارند. از آنجایی‌که در فصل‏های سرد با کاهش دما، فعالیت حشرات نیز کاهش می‌یابد و هوای گرم به تولید ‌مثل بیشتر حشرات منجر می‌‌شود، شرایط آب و هوایی نیز بر میزان آلودگی به تریپانوزوم موثر است (11). بنابراین، در مورد نتایج این مطالعه که تنها در فصول بهار و تابستان موارد آلوده یافت شدند و هیچ نمونه‌ی مثبتی در فصول پاییز و زمستان یافت نشد، ممکن است تحت تاثیر وضعیت آب و هوایی در فصل‏های سرد و گرم قرار گرفته باشند. ازاین‌رو ممکن است کاهش دما در فصل‏های سرد (پاییز و زمستان) بر فعالیت بسیاری از حشرات ناقل این انگل، اثر گذاشته و به عدم آلودگی به تریپانوزوم منجر شده باشد. نتایج این مطالعه از نظر شیوع فصلی با مطالعه‌ی آمر[17] و همکاران در مصر (2011) تا حدودی تشابه دارد. در مطالعه‌ی آمر و همکاران علت احتمالی شیوع پایین در فصول سرد به کاهش فعالیت حشرات ارتباط داده شده است (11).

همانطور که ذکر شد، برخی از گونه‌های تریپانوزوم ممکن است از حیوان به انسان (بیماری مشترک) انتقال یابند و ایجاد بیماری کنند. افرادی که در ارتباط و تماس بیشتری با دام‌ها هستند، امکان آلودگی به تریپانوزوم در آن‏ها به شکل بالقوه وجود دارد. بنابراین، توصیه می‌شود به مردمی که به ارتباط با دام‌ها و دامپروری به‏ویژه در مناطق گرمسیر مشغول هستند، آموزش‌های لازم در این زمینه داده شود.

خوشبختانه نتیجه‌ پژوهش حاضر می‌تواند بیانگر این مسئله باشد که در نمونه‌های متعلق به منطقه‌ی مورد بررسی، آلودگی با تریپانوزوم به میزان کمابیش پایینی وجود دارد که این مسئله نکته‌ مثبتی برای صنعت پرورش شتر کشور محسوب می‌شود. هرگاه بیماری در منطقه‌ای وجود نداشته باشد باید از ورود احتمالی بیماری به آن منطقه پیشگیری نمود. بنابراین، برای جلوگیری از خسارت‌های سنگین و بالقوه‌ی اقتصادی، اقداماتی از قبیل از بین بردن حیوانات بیمار با ارزش اقتصادی پایین و درمان مبتلایان با ارزش اقتصادی بالا، ممانعت از ورود دام‌های مشکوک به بیماری و کنترل تجارت و واردات دام از کشورهایی که آلودگی در آن‏ها بالاست، توصیه می‏شود. همچنین، با توجه به عدم شناسایی دقیق این انگل با روش‌های مرسوم در آزمایشگاه‌های کشور، بکارگیری روش‌های مولکولی با سرعت، دقت و ویژگی بالا، به منظور شناسایی موارد مشکوک، آزمون مداوم دام‌های وارداتی به کشور برای پیشگیری از شایع شدن بالقوه‌ی بیماری به‏ویژه توسط مراکز مسئول در زمینه‌ تجارت و واردات دام توصیه می‏شود. در مواقعی که امکان آزمایش دام‌های وارداتی که از نظر ظاهری سالم هستند به وسیله‌ی آزمون‌های مولکولی وجود ندارد، توصیه می‌شود به وسیله‌ آزمون‌های سریع و ساده‌ای مانند آگلوتینیشن آزمون که برای انجام آن نیاز به متخصص نیست ارزیابی شوند (17).

تشکر و قدردانی

نویسندگان مراتب تشکر خود را از سرکار خانم فاطمه یکتنه کارشناس آزمایشگاه گروه پاتوبیولوژی دانشکده دامپزشکی دانشگاه شهرکرد و سرکار خانم صفرپور کارشناس پژوهشکده بیماری‌های مشترک انسان و دام دانشگاه شهرکرد و کلیه عزیزانی که ما را در انجام این مطالعه یاری نمودند اعلام می‌دارند.

 

 

 



[1]- T. rhodesiense

[2]- T. gambiense

[3]- T. brucei

[4]- T. congolense

[5]- T. vivax

[6]- T. suis

[7]- Glossina

[8]-Trypanosomiasis

[9]- T. equiperdum

[10]- T. evansi

[11]-Pathognomonic

[12]-Gold standard

[13]-Geysen

[14]-Applied Biosystems

[15]-Umshadeeda

[16]-Butana Plains

[17]-Amer

References

(1)               Radostits OM, Blood DC. Veterinary Medicine. London, England: Bailliere Tindall Press; 1994: 1218-20.

(2)               Losos G, Chouinard A. Pathogenicity of Trypanosomes. Proceeding of a workshop held at Nairobi, Kenya, 20-23 November 1978. Ottawa, Canada; Int Develop Res Cent (IDRC) Press. 1979: 230-236.

(3)               Lun ZR, Fang Y, Wang CJ, Brun R. Trypanosomiasis of domestic animals in China. Parasitol Today 1993; 9(2): 41–5.

(4)               WHO. A new form of human trypanosomiasis in India. Wkly Epidemiol Rec 2005; 80(7): 62-3.

(5)               Hagos A, Goddeeris BM, Yilkal K, Alemu T, Fikru R, Yacob HT, et al. Efficacy of Cymerlarsan and Diminasan against Trypanosoma equiperdum infections in mice and horses. Vet Parasitol 2010; 171(3-4): 200-06.

(6)               Brun R, Hecker H, Lun AR. Trypanosoma evansi and T. equiperdum: distribution, biology, treatment and phylogenetic relationship (a review). Vet Parasitol 1998; 79(2): 95-107. .

(7)               OIE. Manual of diagnostic tests and vaccines for terrestrial animals. Trypanosoma evansi infections (including surra). 2008: 352-360. Available at: http://www.oie.int/eng/normes/mmanual/2008/pdf/2. 01. 17_TRYPANO. Pdf.

(8)               Singh N, Pathak KM, Kumar R. A comparative evaluation of parasitological, serological and DNA amplification methods for diagnosis of natural Trypanosoma evansi infection in camels. Vet Parasitol 2004; 30, 126(4): 365-73.

(9)               Borji H, Razmi GH, Parandeh S. Epidemiological study on haemoparasites of dromedary (Camelus dromedarius) in Iran. J Camel Pract Res 2009; 16(2): 217-19.

(10)           Pourjafar M, Badiei K, Sharifiyazdi H, Chalmeh A, Naghib M, Babazadeh M, et al. Genetic characterization and phylogenetic analysis of Trypanosoma evansi in Iranian dromedary camels. Parasitol Res 2013; 112(2):899-903.

(11)           Amer S, Ryu O, Tada C, Fukuda Y, Inoue N, Nakai Y. Molecular identification and phylogenetic analysis of Trypanosoma evansi from dromedary camels (Camelus dromedarius) in Egypt, a pilot study. Acta Tropica 2011; 117(1): 39-46.

(12)           Dirie MF, Wallbanks KR, Aden AA, Bornstein S, Ibrahim MD. Camel trypanosomiasis and its vectors in Somalia. Vet Parasitol 1989; 1, 32(4): 285-91.

(13)           Salim B, Bakheit MA, Kamau J, Nakamura I, Sugimoto C. Molecular epidemiology of camel trypanosomiasis based on ITS1 rDNA and RoTat 1. 2 VSG gene in the Sudan. Parasite Vector 2011; 4(31): 1-5.

(14)           Ranjbar Bahadori Sh, Afshari Moghaddam A. Study on the prevalence of blood parasites in camels of Zabol in 2008. Vet J (Tabriz) 2009; 3(2 (10)): 503-507.

(15)           Zariffard MR, Hashemi Fesharaki R. Study on tissue and blood protozoa of camel in southern Iran. J Camel Practic Res 2000; 7 (2): 193-194.

(16)           Geysen D, Delespaux V, Geerts S. PCR-RFLP using Ssu-rDNA amplification as an easy method for species-specific diagnosis of Trypanosoma species in cattle, Vet Parasitol 2003; 2,110(3-4), 171-80.

(17)           Rafyi A. Protozoalogy veterinary and comparative. Tehran, Iran; Ministry Sci Higher Edu Press 1987: 279-387.