شناسایی ژن‏های حدت ‏yrp1 و yrpE در باکتری یرسینیا راکری به روش PCR در استان چهارمحال و بختیاری

نویسندگان

1 دانشیار بهداشت و بیماری‏های آبزیان، ‏دانشگاه آزاد اسلامی واحد شهرکرد، شهرکرد ،ایران،

2 دانشجوی دکتری دامپزشکی، دانشگاه آزاد اسلامی واحد شهرکرد، شهرکرد ،‏ایران،

چکیده

  مقدمه: یرسینیا راکری عامل بیماری دهان قرمز آنتروباکتریایی و از بیماری‏های مهم آزاد ماهیان پرورشی است. ‏مطالعه حاضر با هدف شناسایی ژن‏های حدت yrp1 و yrpE در باکتری یرسینیا راکری انجام شد .   مواد و روش ‏‏ ها: به منظور انجام این تحقیق، ‏ماهیان 10تا 12 سانتی‏متری 6 مزرعه پرورش ماهی استان چهارمحال و بختیاری، بررسی باکتری‏شناسی شدند. ‏به طوری‏که از هر مزرعه 10 عدد ماهی مشکوک به بیماری ‏(‏در مجموع 60 عدد) به طور تصادفی انتخاب و نمونه برداری از انتهای روده آن‏ها، کشت بر روی محیط‏های غنی کننده (‏تریپتیکاز سوی آگار) و اختصاصی ‏(‏واتمن- شاتس) ‏یرسینیا راکری انجام شد‏. ‏سپس سویه‏های مثبت باکتری یرسینیا راکری با آزمایش PCR شناسایی شد . ‏در مرحله بعد بر روی باکتری‏های شناسایی شده با استفاده از زوج پرایمرهای مربوط به دو ژن حدت به نام‏های yrp1 و yrpE آزمون PCR انجام شد .   نتایج: از تعداد کل نمونه‏های باکتریایی 24 سویه به عنوان باکتری یرسینیا راکری شناسایی شدند که در بین آن‏ها 12 سویه ‏(‏50 درصد) حامل ژن yrp1 و 11 سویه ‏(‏83/45 درصد) حامل ژن yrpE بودند. ‏به طور هم‏زمان نیز 6 سویه ‏(‏25 درصد) هر دو ژن را داشته اند .   بحث و نتیجه ‏ گیری: نتایج تحقیق حاضر نشان از وجود عامل‏‏های حدت yrp1 و yrpE در سویه‏های یرسینیا راکری جدا شده دارد. ‏ yrp1 به عنوان پروتئاز خارج سلولی شناخته شده یرسینیا راکری بوده و نقش مهمی در حدت و بیماری‏زایی این باکتری دارد.  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Detection of virulence genes (yrp1 and yrpE) in the Yersinia ruckeri by polymerase chain reaction test in Chaharmahal-Va-Bakhtiary province, Iran

نویسندگان [English]

  • Firooz Fadaeifard 1
  • Saeed Simin 2
1 Associated professor of Aquatic animal health and disease, Shahrekord Branch,Islamic Azad University, Shahrekord, Iran
2 Student of veterinary medicine, Shahrekord Branch,Islamic Azad University, Shahrekord, Iran
چکیده [English]

  Introduction : Yersinia ruckeri is the etiological agent of enteric redmouth (ERM) disease, one of the important bacterial diseases in the cultured salmonids. The aim of present study was detection of virulence genes (yrpE and yrp1 ) in the Y.ruckeri bacterium   Materials and methods In this study fish were evaluated in average size 10-12 Cm from six rainbow trout farms in Chaharmahal-Va-Bakhtiary province. In each farm 10 fish (totally 60) suspected to ERM were randomly selected, sampling was done from lower part of intestine and cultured on general (trypticase soy agar) and specific (Waltman-Shots) mediums. Finally, colonies that were isolated on these mediums tested by PCR method for Y.ruckeri detection. Then, in the identified strains of Y.ruckeri virulenc genes ( yrp1 and yrpE ) were detected by PCR test.   Results : In the all strains of Y. ruckeri two virulence genes ( yrp1 and yrpE ) were identified by molecular test. 24 strains out of total isolates were identified as Y.ruckeri, and among them 12 cases (50%) and 11 cases (45 . 83%) had yrp1 and yrpE genes, respectively. Also, 6 samples (25%) had both genes simultaneously.   Discussion and conclusion : The study revealed that virulence factor yrp1 is as extracellular protease presence in Y.ruckeri strains. T his factor plays an important role in the bacterial virulence and pathogenesis of ERM disease. Data obtained in this study help to control disease especially in development of current vaccines .

کلیدواژه‌ها [English]

  • Rainbow trout
  • PCR
  • Yersinia ruckeri
  • yrp1
  • yrpE

مقدمه

یرسینیا راکری یک باکتری گرم منفی، ‏میله ­ای شکل، ‏کاتالاز مثبت وسیتوکروم اکسیداز منفی است و در ماهیان قزل آلای رنگین کمان به بروز بیماری دهان قرمز آنتروباکتریایی که شکل بالینی یک سپتی سمی خونریزی دهنده است منجر می‏شود‏ (‏1). ‏واکسیناسیون، ‏بهبود مدیریت بهداشتی، ‏قرنطینه و ایجاد محدودیت حمل و نقل بهترین سیاست در کنترل این بیماری به شمار می‏رود ‏(‏2 و 3). ‏یرسینیا راکری دارای 6 سرووار و 4 سروتیپ شناسایی شده است که O1 حادترین سروتیپ آن به شمار می‏رود (‏4). ‏ماهیان حامل به واسطه انتشار باکتری از روده خود، ‏نخستین منبع عفونت به شمار رفته و البته در این انتقال، ظرفیت سویه‏های وحشی در بقا و باقی ماندن عفونت در محیط‏های آبزی وگاهی اوقات تشکیل بیوفیلم باکتریایی نیز مطرح بوده و حائز اهمیت است (‏5). ‏

در خصوص عوامل حدت و نقش آن در بیماری‏زایی باکتری در سال‏های اخیر مطالعات خوبی انجام شد‏ه است (‏5- 9). ‏چنانچه از نخستین کارهای انجام شد‏ه در زمینه شناسایی عامل‏‏های حدت می‏توان به معرفی یک پلاسمید 40 تا 50 مگادالتونی در برخی از گونه‏های یرسینیای بیماریزای انسانی همچون یرسینیا انتروکولیتیکا، ‏یرسینیا پستیس و یرسینیا سودوتوبرکلوزیس و ارتباط آن با حدت باکتری اشاره کرد که این پلاسمید چندان مشابهت ساختاری با پلاسمید 70-88 کیلوبازی یافته شده در پروفایل پلاسمیدی سرووار I باکتری یرسینیا راکری نداشت اما پلاسمید یرسینیا راکری قادر به کاهش پاسخ‏های لومینسانس شیمیایی ماکروفاژهای ماهی باس راه راه[1] بوده اند. ‏همچنین، بقاء باکتری در محیط خارج از بدن میزبان ‏(‏که در مقایسه با میزبان، مواد غذایی کمتری دارد) در طولانی مدت باعث تسهیل در فرایند انتقال به میزبان و اهمیت بیماریزایی آن می‏شود‏ و به محض انتشار باکتری از ماهیان بیمار یا حامل، ‏آن‏ها در محیط استخر‏ها باقی مانده و آماده شیوع در بین جمعیت ماهیان خواهند بود (‏10). ‏درخصوص نقش تهاجمی برخی پلاسمید‏های باکتری یرسینیا راکری می‏توان گفت که در سویه‏های یرسینیا راکری سروار I، ‏پلاسمیدهای 40 تا 50 مگادالتونی ‏(‏که حامل عامل‏‏ حدت بوده) و برخی پلاسمیدهای کوچکتر 20 تا 30 مگادالتونی شناسایی شده اند ولی در سروار II، ‏پلاسمیدهای بزرگ مشاهده نشد‏ از همین رو شدت بیماری‏زایی این باکتری خیلی ضعیف‏تر از سرووارI است. ‏شواهد نشان می‏دهد که یرسینا راکری ممکن است دارای سیستم جذب آهن با واسطه سیدروفور (‏عامل شلاته کنندگی آهن در محیط و جذب بعدی آن توسط باکتری) باشد (‏1). ‏یکی از عوامل حدت این باکتری ظرفیت تشکیل ساختمان بیوفیلم است که ارتباط با تحرک ناشی از تاژک باکتری‏ها دارد و به افزایش مقاومت به آنتی بیوتیک اکسولونیک اسید منجر می‏شود در نتیجه این ساختار باعث افزایش ماندگاری باکتری در محیط و حفظ قدرت بیماری‏زایی آن می‏شود‏ (‏5). ‏پروتئاز‏ها به عنوان یکی از عامل‏‏های خارج سلولی مرتبط با حدت میکروارگانیسم‏‏ها معرفی شده و به ویژه در باکتری‏های بیماری‏زای ماهیان تجارب علمی نشان از دخالت آنزیم‏های پروتئولیتیکی در بیماری‏زا بودن آن‏ها دارد ‏(‏11). ‏بنابراین، ترشحات خارج سلولی باکتری اعم از لیپاز، ‏پروتئاز وسیتوتوکسین و همچنین، فعالیت‏های همولیتیک آن‏ها به بروز برخی علائم ویژه این بیماری همچون خونریزی در دهان و روده منجر می‏شود‏. ‏همچنین، مشاهده شده که یرسینیا راکری قادر به تهاجم مؤثر به ‏‏لاین‏های سلولی کشت داده شده در شرایط آزمایشگاهی است (‏12). ‏از ژن‏های حدت شناخته شده باکتری یرسینیا راکری می‏توان yrp1 و yrpEرا نام برد. ‏این ژن‏ها در ساخت پروتئازهای خارج سلولی نقش داشته و آنزیم‏های پروتئولیتیکی قادرند اثرات زیادی از قبیل دژنرسانس بافتی، ‏هجوم، ‏فعالیت پروتوکسینی و غیره را داشته باشند. ‏در باکتری یرسینیا راکری ژنyrp1 انکود نمودن یک پروتئاز 47 کیلودالتونی را بر عهده دارد؛ بنابراین، فعالیت‏های پروتئولیتیکی خارج سلولی این باکتری ارتباط با حدت آن دارد. ‏همچنین، توالی نوکلئوتیدی ژن ‏yrp1 ،انکودینگ یک پروتئین 477 آمینواسیدی را بر عهده دارد. ‏با توجه به شباهت زیاد در توالی آمینواسیدهای این پروتئین، ‏آن را در زیر خانواده سرالیزین متالواندوپپتیداز معرفی کرده اند. ‏پروتئاز yrp1 سایر گونه‏های یرسینیا توسط یک سیستم ترشح پروتئینی اکسپورترABC باکتری گرم منفی تیپ I ترشح می‏شود که متشکل از سه ژن به نام‏های yrpD، ‏‏yrpE و yrpF و یک ممانعت کننده پروتئاز به نام inh است (‏13 و 14). ‏در مطالعه حاضر، سعی بر شناسایی دو ژن حدت yrp1 و yrpE در باکتری یرسینیا راکری جدا شده از ماهیان قزل آلای رنگین کمان استان چهارمحال و بختیاری و شناخت بیشتر از وضعیت بیماری‏زایی این باکتری‏ها شده است تا بتوان از اطلاعات به دست آمده در زمینه کنترل شیوع بیماری ناشی از این باکتری بهتر تصمیم‏گیری کرد.

 

مواد و روش‏ها

این تحقیق، در تابستان 1391 در مزارع پرورش ماهی استان چهار محال و بختیاری انجام شد‏. ‏انتخاب این مزارع به علت وقوع قبلی بیماری یرسینیوز وگزارش‏های اعلام شده در خصوص بروز بیماری ذکر شده انجام شد‏. ‏بنابراین، از 6 مزرعه پرورشی و از هر مزرعه تعداد 10 عدد ماهی مشکوک به بیماری با اندازه متوسط 10 الی 12سانتی‏متر به شکل تصادفی نمونه‏برداری شد که در مجموع تعداد کل نمونه‏‏ها برابر با 60 عدد شد‏. ‏قبل از انجام عملیات نمونه برداری نسبت به اخذ اطلاعات کامل مزرعه ای از قبیل عامل‏‏های مربوط به آب ‏(‏عامل‏‏های کیفی از جمله دما و اکسیژن)‏، ‏ماهی (‏مشاهدات بالینی و کالبدگشایی ماهیان تلف شده و زنده) و غذا ‏(‏ویژگی‏های فیزیکی و ‏شیمیایی غذا) و تکمیل پرسشنامه‏های مربوطه اقدام شد‏. ‏سپس، ماهیان صید شده به اتاق اداری مزرعه برای نمونه برداری انتقال داده شدند و ابتدا با وارد نمودن چند ضربه به سر، ‏آن‏ها را بی هوش و سپس با الکل اتیلیک سطح بدن ماهیان کاملاً ضد عفونی شد‏. ‏در ادامه با باز کردن سطح شکمی ماهی و در کنار شعله توسط آنس استریل از انتهای روده نمونه برداری انجام شد‏ به طوری که با تخلیه مواد مدفوعی داخل روده، ‏بر روی سطح مخاط آن محل آنس کشیده شد. سپس نمونه‏ها به محیط کشت تریپتیک سوی آگار[2] ‏(‏به عنوان یک محیط اولیه وعمومی در باکتری‏های آبزیان) انتقال داده ‏شدند. ‏بر روی تمام محیط‏‏ها شماره و کد مربوطه درج شد. پس از اتمام عملیات نمونه‏گیری در کنار یخ به آزمایشگاه میکروب‏شناسی دانشگاه آزاد اسلامی واحد شهرکرد انتقال داده، به مدت 48 ساعت درانکوباتور با دمای22 درجه سانتی‏گراد نگهداری شدندتا رشد پرگنه‏های مشکوک انجام ‏شود. ‏پس از رشد پرگنه‏‏ها از هر کدام آزمایش‏های بیوشیمیایی کاتالاز، ‏اکسیداز و همچنین، رنگ آمیزی گرم انجام شد‏ه و آن‏هایی که کاتالاز مثبت، ‏اکسیداز منفی و گرم منفی بوده اند برای انتقال به محیط کشت واتمن شاتس[3] ‏(‏محیط اختصاصی یرسینیا راکری) انتخاب ‏می‏شدند. ‏پس از 24 تا 48 ساعت گرم‏خانه گذاری دردمای 22 درجه سانتی‏گراد، پرگنه‏های رشد یافته در آن‏ها جدا و به محیط آب پپتونه منتقل، سپس به مدت 24 ساعت در انکوباتور با دمای 22 درجه سانتی‏گراد نگهداری شدند‏ تا در ادامه از آن‏ها برای استفاده در آزمون PCR استفاده شود. ‏

استخراج DNA

استخراج DNA از نمونه‏های باکتریایی بر اساس دستور العمل کیت استخراج DNA ساخت شرکت سیناژن انجام شد. ‏

انجام PCR برای تشخیص باکتری یرسینیا راکری

برای تشخیص باکتری یرسینیا راکری، ‏واکنش PCR با استفاده از پرایمرهای مربوطه و بر اساس دستورالعمل توصیه شده توسط دلسرو و همکاران [4] انجام شد‏ (‏15). ‏بدین منظور از پرایمرهای الیگونوکلئوتیدی که ردیابی قطعه 573 جفت بازی ژن SrRNA16 مربوط به باکتری یرسینیا راکری را بر عهده دارند استفاده شد (‏جدول1). ‏در این واکنش از برنامه حرارتی مرحله واسرشته‏سازی اولیه در 94 درجه سانتی‏گراد به مدت 2 دقیقه، ‏مرحله واسرشته‏سازی در 94 درجه سانتی‏گراد به مدت 40 ثانیه، ‏مرحله اتصال در 60 درجه سانتی‏گراد به مدت 40 ثانیه، ‏توسعه در 72 درجه سانتی‏گراد به مدت 40 ثانیه ‏(‏مراحل واسرشته‏سازی، ‏اتصال و توسعه 35 بار تکرار شدند‏) و مرحله توسعه نهایی در 72 درجه سانتی‏گراد به مدت 5 دقیقه استفاده شد‏. ‏پس از انجام واکنش PCR بر روی نمونه‏های مشکوک باکتریایی، ‏تعداد 24 سویه یرسینیا راکری شناسایی و نسبت به انجام واکنش ردیابی ژن‏های حدت آماده‏سازی شد‏ند. ‏در این مرحله با داشتن سویه‏های مثبت یرسینیا راکری نسبت به ردیابی ژن‏های yrp1 و yrpEبر اساس پروتکل پیشنهادی فرناندز و همکاران[5] اقدام شد‏ (‏13) ‏(‏جدول2). ‏به‏طوری‏که در انجام واکنش PCR از برنامه دمایی واسرشته‏سازی اولیه در 94 درجه به مدت 5 دقیقه، ‏واسرشته‏سازی در 94 درجه به مدت30 ثانیه، ‏اتصال در 43 درجه ‏(‏برای yrp1) و 47 درجه ‏(‏برای yrpE)‏ به مدت 30 ثانیه، ‏توسعه در 72 درجه به مدت یک دقیقه و توسعه نهایی در دمای 72 درجه به مدت 7 دقیقه استفاده شد. مراحل دو تا چهار، ‏25 بار تکرار شد‏ند. ‏

 

نتایج

طی بررسی مزارع پرورش ماهی قزل آلای رنگین کمان استان چهار محال و بختیاری و نمونه برداری از 60 عدد ماهی مشکوک به بیماری دهان قرمز آنتروباکتریایی برای ردیابی ژن‏های حدت yrp1 و yrpEباکتری یرسینیا راکری، ابتدا سویه‏های یرسینیا راکری شناسایی و در کنار سویه استاندارد این باکتری تعداد 24 عدد باکتری نیز شناسایی شدند (‏شکل1). ‏سپس، این باکتری‏‏ها نیز برای ردیابی ژن‏های حدت استفاده شدند که در شکل2 نشان داده شده است. ‏نتیجه توزیع ژن‏های بررسی شده به نسبت درصد آن‏ها در باکتری‏های شناسایی شده نیز در جدول 3 آمده است. ‏همان‏طور که مشاهده می‏شود 12 باکتری ‏(‏50 درصد) دارای ژنyrp1 و 11 باکتری ‏(‏83/45 درصد) دارای ژن yrpE بوده، ‏همچنین، 6 سویه ‏(‏25 درصد) نیز به‏طور هم‏زمان دو ژن yrp1 و yrpEرا داشتند. ‏

 

 

جدول1- مشخصات پرایمرهای مورداستفاده در تشخیص باکتری یرسینیا راکری

پرایمر ‏ ‏‏ ‏

اندازه قطعه ژنی ‏(‏جفت باز)

ژن هدف

منبع

‏‏ yer3,5 CGAGGAGGAAGGGTTAAGT3
yer4,5 AAGGCACCAAGGCATCTCT3

573

S rRNA16

15

 

جدول2- مشخصات پرایمرهای استفاده شده در ردیابی ژن‏های حدت yrp1 و yrpE

پرایمر ‏

نام ژن

اندازه قطعه ژنی ‏(‏جفت باز)

منبع

(F):5´GCCAAGATCTCATTACAATCTTGGGCA3´

YRPP1

787

13

(R):5´-CGTTAGATCTCGCACCATGTAATTCAT3´

YRPP2     

787

(F):5´-GCCAAGATCTGGGTTGACTGCGCAATA-3´ 

YRPE1

820

(R):5´- CGTTAGATCTGTTTCACGGTGCCTTCT-3´

YRPE2

820

 

 

جدول 3- توزیع ژن‏های بررسی شده در باکتری‏های یرسینیا راکری شناسایی شده

نوع ژن بررسی شده ‏ ‏

تعداد

درصد

yrp1 ‏‏

12

50

yrpE  ‏‏

11

83/45

 

 

شکل1- تصویر ژل آگاروز: ردیابی ژن SrRNA16 با تکنیک PCR، ‏لاینM: نشانگر100 جفت بازی، ‏لاین1: کنترل منفی،
‏لاین 2و3، ‏: ‏نمونه‏های مثبت یرسینیا راکری، ‏باند4: کنترل مثبت

 

 

شکل2- شناسایی هم‏زمان ژن‏های حدت  yrp1و yrpE باکتری یرسینیا راکری در ژل آگاروز با تکنیک PCR، ‏
لاینM: نشانگر100 جفت بازی، ‏لاین1: کنترل منفی، ‏لاین2و3: باند 820 جفت باز ژن yrpE، ‏لاین4و5: باند 787جفت باز ژن yrp1

 

بحث و نتیجه­گیری

بیماری دهان قرمز آنتروباکتریایی از بیماری‏هایی مهم باکتریایی در بین آزادماهیان پرورشی است که با توجه به پرورش گسترده ماهی قزل آلای رنگین کمان در کشورمان گاهی گزارش‏هایی از مشاهده تلفات ناشی از این بیماری از نقاط مختلف انجام شد‏ه است. ‏بنابراین، با توجه به اهمیت همه‏گیرشناسی آن و از آن‏جایی که استان چهار محال و بختیاری از مناطق مهم اقتصادی و پر تولید این ماهی در کشورمان به شمار می‏رود، ‏تحقیق حاضر در راستای شناسایی عوامل حدت باکتری‏های یرسینیا راکری و با هدف ردیابی دو ژن حدت yrp1 وyrpE انجام شد. ‏‏همان‏طور که در نتایج پژوهش نیز آمد درسویه‏های یرسینیا راکری جدا شده از ماهیان قزل آلای پرورشی ژن‏های یاد شده ردیابی شد. به طوری که ژنyrp1 در50 درصد سویه‏ها، ‏yrpE در83/45 درصدسویه‏‏ها و هم‏زمان25 درصد سویه‏‏ها هر دو ژن را داشته اند. ‏شناسایی یرسینیا راکری در ایران نخستین بار در سال 1376 و از مزارع پرورشی استان چهار محال و بختیاری انجام شد‏ در این ‏مطالعه با استفاده از آزمایش‏های بیوشیمیایی، ‏باکتریولوژیک و سرولوژیک سویه‏های یرسینیا راکری از ماهیان قزل آلای رنگین کمان جداسازی و تشخیص داده شد. ‏به طوری که با بهره‏جویی از آزمون‏های ایمونوفلورسانس آنتی بادی درخشان ‏(‏به روش غیر مستقیم) 6 سویه باکتری یرسینیا راکری شناسایی شد‏ند ‏(‏16). ‏در ادامه نیز با مطالعه بر روی ماهیان قزل آلای رنگین کمان پرورشی استان فارس و نمونه برداری از ماهیان مشکوک به بیماری با استفاده از آزمایش PCR این باکتری ردیابی وشناسایی شد. ‏این کار نخستین گزارش شناسایی باکتری نامبرده با استفاده از تکنیک‏های مولکولی در استان فارس بوده است (‏17). ‏اما در ادامه روند شناسایی باکتری فوق یکی از تحقیقات انجام شده در زمینه ویژگی‏های ژنی باکتری یاد شده، کار انجام شده توسط فدایی فرد و همکاران[vi] ‏ بوده است که ایشان با بررسی ماهیان قزل آلای سه منطقه کیار، ‏کوهرنگ و اردل استان چهارمحال و بختیاری موفق به ردیابی دو ژن حدت yhlA و ‏yhlB شد‏ند. ‏این ژن‏ها ارتباط زیادی با فعالیت همولیزینی وسیتولیزینی باکتری یاد شده داشته و فرآیند خونریزی در اندام‏های داخلی و خارجی ماهی را می‏توان به عملکرد این ژن‏ها نسبت داد (‏18). ‏نتیجه تحقیق حاضر نیز به شناسایی ژن‏های حدت yrp1 و yrpEدر باکتری یرسینیا راکری منجر شد‏ که توجیه کننده اثرات پروتئولیتیکی این باکتری بوده و در کنار تحقیقات قبلی تکمیل کننده فرآیندهجومی و آسیب‏شناسی آن است. در سال‏های اخیر گزارشات متعددی از سوی مراجع دامپزشکی در زمینه بروز و شیوع بیماری دهان قرمز آنتروباکتریایی در ماهیان قزل آلای پرورشی استان انجام شد‏ه است که شدت تلفات و ظهور علائم کلینیکی بیماری، تأیید کننده عوامل حدت در باکتری‏های یاد شده، است. ‏هم راستا با تحقیق حاضر در ارتباط با حدت باکتری یرسینیا راکری و نقش آن در بیماری‏زایی این باکتری تحقیقات زیادی انجام شد‏ه است ‏(‏1، ‏4، ‏7، ‏8 و 13). ‏یکی از اثرات مهم پروتئاز‏های خارج سلولی در بروز علائم ویژه دهان قرمز و خونریزی روی دهان و کام است که تورنزو و همکاران[vii] ‏این علائم بالینی را به تأثیر سموم خارج سلولی باکتری یرسینیا راکری نسبت دادند. نظر به شناسایی ژن‏‏های yrp1 و yrpEدر تحقیق حاضر تأثیر این عوامل در بروز علائم آسیب شناختی بیماری تقویت پیدا می‏کند (19). ‏همچنین، موضوع چسبندگی[viii] و هجوم باکتریایی[ix] که از ویژگی‏‏های مهم حدت باکتری‏‏ها به شمار می‏روند نیز از جمله عامل‏‏‏های مؤثر در بیماری‏زایی باکتری یرسینیا راکری بوده و ثابت شده که این باکتری قدرت هجوم و چسبیدن به ‏لاین‏‏های کشت‏های سلولی را دارد. این مسأله به نوعی شدت بیماری دهان قرمز آنتروباکتریایی و اثرات آسیب شناختی ناشی از آن را در مزارع پرورشی توجیه می‏کند (‏20). ‏مطالعات تکمیلی‏تر در زمینه ساختار‏شناسی ژن yrp1 را فرناندز و همکاران انجام دادند. ‏ایشان با بررسی ‏‏سویه‏های یرسینیا راکری جمع آوری شده از مزارع مختلف ماهی قزل آلای رنگین کمان موفق به شناسایی و انکود نمودن این پروتئازخارج سلولیشد‏ند البته این کار به نوعی ارتباط با کارهای قبلی در خصوص وجود پروتئین 47 کیلودالتونی مرتبط با حدت باکتری دارد (‏13). ‏مجموعه پژوهش‏های انجام شد‏ه بر روی عامل‏‏های حدت باکتری یرسینیا راکری و ردیابی ژن‏های حدت yrp1 و yrpEدر پژوهش حاضر گویای وجود عوامل ایجاد کننده ضایعات آسیب شناختی مهم در ایجاد علائم بالینی بیماری دهان قرمز و همچنین، بروز تلفات ناشی از آن است. ‏به نظر می‏رسد که تجمع و تهاجم از مکانیسم‏های اصلی این باکتری‏ها در طول دوره تعامل پاتوژن- میزبان[x] باشند. ‏بنابراین، وجود آنزیم‏هایی مثل کلاژنازها، ‏الاستازها و ژلاتینازها در این باکتری‏ها به بروز ضایعات در بافت‏های هم بندی و عضلات منجر شده و نقش مهمی در بیماری‏زایی ماهیان دارند(21). ‏به علاوه، ابزارهای ژنتیکی همچون برش (‏کوتاه نمودن) ژن‏های پروتئولیتیکی انکود کننده، نشان داده که ‏‏آنزیم‏های پروتئویکی، ‏درگیر در حدت باکتری‏های بیماریزای ماهی هستند ‏(‏22). ‏در کنار ژن yrp1 وyrpE ژن‏های شناخته شده دیگری همچون yhlA وyhlB ‏نیز نقش در بیماری‏زایی دارند چنانچه yhlA سیتولیزین خارج سلولی نقش داشته و فعالیت آن توسط دما و آهن تنظیم می‏شود‏ که در مجموع در حدت باکتریایی و خاصیت سیتوتوکسینی آن اثر ویژه‏ای دارد. ‏فعالیت همولیزین yhlA ارتباط زیادی با فعالیت سایتوپاتیکی باکتری داشته و به احتمال زیاد از آهن موجود در سلول‏های میزبان استفاده می‏کند، ‏yhlB ‏نیز در تولید همولیزین نقش مهمی دارد (‏8). ‏آهن یک پیش نیاز برای تجمع موفق و در نهایت تهاجم بسیاری از پاتوژن‏های میکروبی به شمار می‏رود. ‏تحقیقات در زمینه باکتری یرسینیا راکری نیز ثابت کرده که این باکتری نیز برای رشد نیاز به ترکیبات شلاته کننده آهن دارد تا بتواند آهن مورد نیاز خود را از محیط دریافت کند. ‏ژن‏های درگیر در ساخت کاته کولات سیدروفور به نام راکر باکتین معروف هستند که برخی از این ژن‏ها در همان منطقه کروموزومی تشکیل دهنده خوشه ژنی قرار می‏گیرند که شبیه خوشه ژنی آنتروباکتین باکتری‏ای کولای است (‏7 و 23). ‏همچنین، نشان داده شده که باکتری یرسینیا راکری حاوی ‏فراورده‏های خارج سلولی اعم از لیپاز، ‏پروتئاز و فعالیت‏های همولیتیکی و خواص سیتوتوکسیکی در برخی محیط‏های کشت سلولی است (‏4). ‏از نتایج مهم ردیابی عامل‏‏های حدت استفاده از آن‏ها در ساخت واکسن و اثر آن‏ها در میزان ایمنی ماهی است. ‏بنابراین، شناخت این ژن‏هادر آگاهی از میزان بیماری‏زایی آن‏ها و همچنین، استفاده از سویه‏های مشخص در ساخت واکسن مهم خواهد بود. ‏که در این میان می‏توان به یکی از عامل‏‏های خارج سلولی حدت میکروارگانیسم‏‏ها یعنی پروتئازها اشاره کرد (‏24). با وجود واکسن‏هایی با قدرت اثر مناسب و تجویز برای دوره‏های طولانی مدت، همچنان شیوع بیماری دهان قرمز را در مناطقی که به صورت بومی ‏(‏اندمیک) درآمده اند، می‏توان مشاهده کرد. چنانچه این واکسن‏ها قادر به ایجاد محافظت لازم علیه بیوگروه‏های جدیدی که به تازگی در کشورهای مختلف جداسازی شده اند نیستند(‏12 و 25). ‏باکتری یرسینیا راکری به طور مداوم باعث خسارات اقتصادی زیاد در صنعت آبزی پروری شده است ولی توسعه ابتدایی واکسن این باکتری باعث کنترل نسبی بیماری می‏شود‏. ‏بنابراین، ممکن است این یکی از دلائلی باشد که چرا مکانیسم‏های اختصاصی بیماری‏زایی این باکتری تا کنون به شکل دست نیافتی باقی مانده است. ‏ثابت شده که کسب آهن توسط سیدروفور راکر باکتین، ‏فعالیت‏های پروتئولیتیکی و همولیتیکی و مقاومت در برابر مکانیسم‏های ایمنی میزبان از عوامل درگیر در بیماری‏زایی این باکتری به شمار می‏روند. ‏شناخت و اطلاعات به دست آمده از این باکتری در دراز مدت به روشن شدن وضعیت بحث‏بر‏انگیز طبقه بندی آن کمک کرده و راهکارهای جدید مقابله با شیوع بیماری با توجه به ناکارآمد بودن واکسن‏های تجاری در برابر برخی از سویه‏های جدید را ارائه ‏خواهد داد (‏26). ‏

گزارش‏های اندکی در مورد وضعیت ژن‏های حدت در سویه‏های یرسینیا راکری وجود دارد و مطالعه حاضر از معدود مطالعاتی است که در کشور انجام شد‏ه است. ‏اگرچه همه سویه‏های یرسینیا راکری در این مطالعه، ‏واجد ژن‏های حدت بررسی شده نبودند، ‏اما به علت رخداد بالقوه سویه‏های حاد و احتمال بروز خسارات اقتصادی و عدم شناسایی این سویه‏ها با روش‏های مرسوم در آزمایشگاه‏های کشور، ‏بکارگیری روش‏های مولکولی با سرعت، ‏دقت و ویژگی بالا، ‏به منظور شناسایی موارد مشکوک به یرسینیوز حاد ضروری به نظر می‏رسد. ‏از این رو توصیه می‏شود مطالعه بیشتری در زمینه بررسی عوامل تأثیر‏گذار در بروز یرسینیوز حاد که در این مطالعه، بررسی نشده اند، انجام شود. ‏‏با توجه به رشد سریع آبزی پروری در کشور ما به ویژه قزل آلای رنگین کمان و افزایش تراکم این ماهی در مزارع پرورش ماهی، ‏بروز بیماری‏های عفونی در آینده چندان دور از انتظار نیست. ‏بنابراین، وظیفه کارشناسان و متخصصان بخش آموزشی، ‏تحقیقاتی و اجرایی این است که در برای ساماندهی این مزارع و اجرای فرآیندهای کنترلی و بهداشتی، ‏بیش از پیش فعالیت نموده و در این میان توجه به تنوع ژنتیکی ‏‏باکتری‏ها و همچنین، شناسایی ژن‏های حدت آن‏ها کمک شایانی به پیاده‏سازی پروتکل‏های پیشگیرانه دارد.

 

 

 

 

 

 

 

References

 



[1]. Striped bass

[2]. TSA

[3]. Waltman-Shotts

[4]. Delcero et al

[5]. Fernandez et al

[vi]. Fadaeifard et al

[vii]. Torenzo et al

[viii]. Adhesion

[ix]. Invasion ‏

[x]. Host-Pathogen interaction

 

 

 

References

(1)  Austin B, Austin DA. ‏Bacterial Fish Pathogens: Diseases of Farmed and Wild Fish. ‏4th ed, UK, Chichester: Praxis Publishing, 2007: 112-127. ‏

(2)  Jalali Jafari B, Miar M. ‏Salmonid and Trout diseases. ‏Tehran: Noorbakhsh publisher; 1999: 87-93. ‏

(3)   ‏Soltani M. ‏Bacterial diseases of fishes. ‏Tehran: Veterinary Organization publisher; 1996; 136-166. ‏

(4)   Romald JL, Toranzo AE. ‏Pathological activities of Yersiania rucker, the Enteric Redmouth Bacterium, FEMS Microbiol Lett. ‏1993; 112 ‏(‏3): 291-99. ‏

(5)   Coquet L, Cosette P, Quillet L, Petit F, Junter GA, Jouenne T. ‏Occurrence and phenotypic characterization of Yersinia ruckeri strains with biofilm-forming capacity in a rainbow trout farm. ‏Appl. Environ. Microbiol. ‏2002 ;68 (‏2)‏: 470-75. ‏

(6)   Fernández L, López JR, Secades P, Menéndez A, Márquez I, Guijarro JA. ‏In vitro In vitro and in vivo in vivo studies of the Yrp1 protease from Yersinia ruckeri and its role in protective immunity against enteric redmouth disease of salmonids. ‏Appl. Environ. Microbiol. ‏2003; 69 (‏12)‏: 7328-35. ‏

(7)   Fernández ‏L, Márquez I, ‏Guijarro ‏JA. ‏Identification of specific in vivo-induced ‏(‏ivi) genes in Yersinia ruckeri and analysis of ruckerbactin, a catecholate siderophore iron acquisition system. ‏Appl. Environ. Microbiol. ‏2004;70 (‏9)‏: 5199–207. ‏

(8)   Fernández L, Prieto ‏M, Guijarro ,JA. ‏The iron and temperature regulated haemolysin YhlA is a virulence factor of ‏Yersinia ruckeri, Microbiology. ‏2007a; 153 (‏pt 2)‏: 483-89. ‏

(9)   Furones MD, Gilpin ML, Alderman DJ, Munn CB. ‏Virulence of Yersinia ruckeri serotype 1 strains is associated with a heat sensitive factor ‏)HSF) in cell extracts. ‏FEMS Microbiol Lett,. ‏1990; 66 (‏1-3)‏: 339–44.

 

(10)             Stave ‏JW , Cook TM , Roberson BS. ‏Chemiluminescent responses of striped bass, Morone saxatilis ‏)Walbaum) ‏, phagocytes to strains of Yersin ia ‏ruckeri. ‏J Fish Dis. ‏1987; 10 (‏1): 1–10. ‏

(11)             P, Alvarez B , Guijarro JA. ‏Purification and characterization of a psychrophilic calcium induced, growth-phase-dependent metalloprotease from the fish pathogen Flavobacterium psychrophilum. ‏Appl Environ Microbiol. ‏2001;67 (‏6): 2436-44. ‏

(12)             Secades ‏Fouz B, Zarza C , Amaro C. ‏First description of non-motile Yersinia ruckeri serovar I strains causing disease in rainbow trout, Oncorhynchus mykiss) Walbaum) ‏, cultured in Spain. ‏J fish dis. ‏2006; 29 (‏6): 339-46. ‏

(13)             Fernández L, Secades P, Lopez JR, Marquez I ,Guijarro ‏JA. ‏Isolation and analysis of a protease gene with an ABC transport system in the fish pathogene Yersinia rackeri: insertional mutagenesis and involvement in virulence. ‏Microbiology. ‏2002: 148 (‏pt7): 2233-43. ‏

(14)             Secades P, Guijarro JA. ‏Purification and characterisation of an extracellular protease from the fish pathogen Yersinia ruckeri and effect of culture conditions on production. ‏Appl. ‏Environ. ‏Microbiol. ‏1999; 65 (‏9): 3969–75. ‏

(15)             ‏Delcero A, Marquez I, Guijarro JA. ‏Simultaneous Detection of ‏Aeromonas salmonicida , Flavobacterium psychrophilum, and Yersinia ruckeri, Three major Fish Pathogen , by MultiplexPCR, Appl. ‏Environ. ‏Microbiol. ‏2002; 68 (‏10): 5177-80. ‏

(16)             ‏‏Soltani M, Fadaifard F , Mehrabi ‏MR. ‏First report of a yersiniosis-like infection in farmed rainbow trout. ‏Bull Eur Assn Fish Pathol. ‏1999; 19 (‏4): 173-76. ‏

(17)             ‏Akhlaghi M , Sharifi Yazdi H. ‏Detection and identification of virulent Yersinia ruckeri: the causative agent of enteric redmouth disease in rainbow trout ‏(‏Oncorhynchus mykiss) cultured in Fars province, Iran. ‏Iranian J Vet Res. ‏2008; 9 (‏4): 347-52. ‏

(18)             Fadaeifard F, Momtaz H,Raissy M,Seemin S. ‏Molecular detection of virulence genes (yhlA, yhlB) in the Yersinia ruckeri. ‏J Mod Vet Res. ‏2011; 3 (‏3): 7-11. ‏

(19)            ‏Toranzo AE, Barja JL, Colwell RR, Hetrick FM. ‏Characterisation of plasmids in bacterial fish pathogens. ‏Infect. ‏Immun. ‏1983; 19: 184–92. ‏

(20)            Kawula TH, Lelivelt MJ , Orndorff PE. ‏Using a new inbred fish model and ‏cultured fish tissue cells to study Aeromonas hydrophila and Yersinia ruckeri pathogenesis. ‏Microbial Pathogenesis. ‏1996; 20: 119-25. ‏

(21)            Binet R, Létoffé S, Ghigo J, Delapelaire P, Wandersman C. ‏Protein secretion by gram negative bacteria ABC export: a review. ‏Gene. ‏1997; 192 (‏1): 7-11. ‏

(22)            Cascón A, Yugueros J, Temprano A, Sánchez M, Hernanz C, Luengo JM et al. ‏A major secreted elastase is essential for pathogenicity of Aeromonas hydrophila. ‏Infect Immun. ‏2000; 68 (‏6); 3233-41. ‏

(23)            Faraldo-Gomez J, Sanson MSP. ‏Acquisition of siderophores in gram-negative bacteria. ‏Nature Reviews. ‏2003; 4 (‏2)‏: 105-16. ‏

(24)            Secades P ,Alvarez B ,Guijarro JA. ‏Purification and properties of a new psychrophilic metalloprotease ‏(‏Fpp2) in the fish pathogen Flavobacterium psychrophilum. ‏FEMS Microbiol ‏Lett. ‏2003; 226 (‏2)‏: 273–79. ‏

(25)            Arias CR, Olivares-Fuster O. ‏Hayden, K. ‏First report of Yersinia ruckeri biotype 2 in the USA. ‏J Aquat Anim Health. 2007; 19 (‏1): 35–40. ‏

(26)            Fernández L, Méndez J, Guijarro JA. ‏Molecular virulence mechanisms of the fish pathogen Yersinia ruckeri. ‏Vet Microbiol. ‏2007b; 125 (‏1-2): 1-10.