بررسی مقاومت به آنتی بیوتیک‏ها‏ی بتالاکتام در جدایه‏ها‏ی اشریشیا کلی و جستجوی مولکولی اشریشیا کلی O157:H7 در پرندگان زینتی شهرکرد

نویسندگان

1 دکتری دامپزشکی، دانشگاه شهرکرد، ایران

2 کارشناس ارشد باکتری شناسی، دانشگاه شهرکرد، ایران

3 دانشیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران

4 دانشجوی دکتری دامپزشکی، دانشگاه شهرکرد، ایران

5 دکتری داروسازی، دانشگاه علوم پزشکی جندی شاپور اهواز، ایران

چکیده

  مقدمه : پرندگان زینتی می‏‏توانند عوامل بیماری‏زای انسانی را در خود جای دهند و در انتقال و گسترش عوامل عفونی مقاوم به دارو به انسان نقش داشته باشند. با توجه به علاقه بسیاری از مردم در نگه ‏ داری از پرندگان زینتی، مطالعه حاضر با مطالعه بر روی پرندگان زینتی شهرکرد، اشریشیا کلی‏ها‏ی مقاوم به آنتی بیوتیک‏ها‏ی بتالاکتام و جستجوی مولکولی اشریشیا کلی O157:H7 بررسی شدند. شایان ذکر است اشریشیا کلی O157:H7 عامل بیماری‏ها‏ی روده ای انسانی و سندروم مرگبار اورمی همولیتیک در دنیاست‏‏.   مواد و روش‏‏ها: در مجموع 256 نمونه مدفوعی از پرندگان زینتی (مرغ عشق، بلدرچین، بلبل، طوطی، مینا، سهره، فینچ، مرغ بهشتی، طاووس و قرقاول) از نقاط مختلف شهرکرد به وسیله ی سواب استریل جمع آوری شدند. سواب‏ها‏ مستقیما درون محیط آبگوشت تریپتون سوی ( TSB ) قرار داده شدند. در آزمایشگاه نمونه‏ها‏ بر روی محیط‏ها‏ی مکانکی آگار و مکانکی محتوی آگار سوربیتول به عنوان محیط‏ها‏ی انتخابی کشت داده شدند. سپس آزمون آنتی‏بیوگرام با استفاده از روش انتشار دیسک انجام شد. کلونی‏ها‏ی مشکوک به اشریشیا کلی O157:H7 به وسیله آزمون واکنش زنجیره ای پلی مراز ( PCR ) ارزیابی شدند.   نتایج: اشریشیا کلی از 31 نمونه (1/12 درصد) از 256 نمونه جداسازی شد. میزان مقاومت جدایه‏ها‏ به آنتی‏بیوتیک‏ها‏ی ایمیپنم، سفوتاکسیم، سفیکسیم، سفالکسین، آموکسی سیلین، پنی سیلین جی و اگزاسیلین به ترتیب صفر، 2/3، 1/16، 3/90، 100، 100 و 100 درصد بود. در هیچ کدام از نمونه‏ها‏ اشریشیا کلی O157:H7 یافت نشد.   بحث و نتیجه‏گیری: گرچه پرندگان زینتی در این منطقه منبع یا حامل اشریشیا کلی O157:H7 نبودند، اما اشریشیا‏کلی‏ها‏ی مقاوم به آنتی بیوتیک‏ها‏ی بتالاکتام را در خود جای داده بودند و می‏‏توانند عامل مهمی در انتقال عفونت‏ها‏ی مقاوم به دارو از پرندگان زینتی به انسان، به ویژه کودکان تلقی شوند و خطری بالقوه برای سلامت انسان ایجاد کنند. با توجه به آنچه ذکر شد توصیه می‏‏شود، صاحبان پرندگان زینتی و همچنین عموم مردم را از خطرات بالقوه ی نگه داری از پرندگان زینتی آگاه کرد.  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

An Investigation of beta-lactam antibiotics resistance in Escherichia coli isolates and molecular detection of Escherichia coli O157:H7 in cage birds from Shahrekord, Iran

نویسندگان [English]

  • Hossein Tahmasby 1
  • sara Barati 2
  • Hassan Momtaz 3
  • Mohammad Rafiee Dolatabadi 1
  • Mohammad Ghasemi 4
  • Vahid Ahmadi Salianeh 5
  • Samaneh Mehrabiyan 1
1 DVM, University of Shahrekord, Iran
2 M.Sc. in Bacteriology, University of Shahrekord, Iran
3 Associate Professor of Microbiology, Shahrekord Branch, Islamic Azad University, Iran
4 DVM Student, University of Shahrekord, Iran
5 Pharm.D, Faculty of Pharmacy, Ahvaz Jondishapour University of Medical Sciences, Ahvaz, Iran
چکیده [English]

  Introduction: Cage birds can harbor human pathogens and contribute to the transmission and spread of drug resistant infectious agents to human. Since many people are interested in keeping cage birds, present study was conducted in cage birds from Shahrekord to investigate the beta-lactam antibiotics resistant E. coli and molecular detection of E. coli O157:H7 that is responsible for outbreaks of human intestinal diseases and fatal haemolytic-uraemic syndrome worldwide .   Materials and methods: Altogether 256 samples of cage birds (lovebirds, quails, nightingales, parrots, mynahs, goldfinchs, finches, kingbirds, peacocks, and pheasants) faeces were collected with sterile cotton swabs from different areas of Shahrekord, Iran. Swabs were placed directly into Tryptone Soya Broth (TSB). In the laboratory, samples were streaked onto MacConkey agar and also Sorbitol MacConkey agar as selective plating media. Then, antibiogram tests were performed using disc diffusion method. Suspected colonies to E. coli O157 : H7 were tested by polymerase chain reaction (PCR) .   Results: E. coli was isolated from 31 (12.1%) out of 256 the samples. Resistance of isolates to Imipenem, Cefotaxime, Cefixime, Cefalexin, Amoxicillin, Penicillin G and Oxacillin was 0, 3.2, 16.1, 90.3, 100, 100 and 100% respectively. E. coli O157:H7 was not found in any samples .   Discussion and conclusion : Although cage birds were not sourcee or carriers of E. coli O157:H7 in the studied region, they harbored beta-lactam antibiotics resistant E. coli and could be an important component of drug-resistant infections transmission from cage-birds to human, especially to kids and can pose a potential risk to human health . For this reason, it is recommended to make pet birds owners and general public aware of potential dangers of cage bird keeping .  

کلیدواژه‌ها [English]

  • Escherichia coli
  • Cage bird
  • Antibiotic resistance
  • PCR

مقدمه

مطالعات همه‏گیر شناختی در سراسر دنیا برای اطلاع از وضعیت میکروبی پدیده‏ها‏ی مختلف و به ویژه نقش آن‏ها‏ در انتقال پاتوژن‏ها‏ به انسان ضروری است. این مطالعات می‏‏توانند منابع اطلاعاتی ارزشمندی را برای مبارزه با بیماری‏ها‏ی انسانی، یافتن منابع و سرآغاز، کنترل و یا ریشه کنی آن‏ها‏ را فراهم آورند.

پرندگان زینتی می‏‏توانند بعضی از بیماری‏ها‏ را در خود جای دهند و به صاحبان خود منتقل کنند. اگرچه مالکیت این پرندگان بدون خطر نیست، اما بسیاری از مردم در منزل خود از پرندگان زینتی مراقبت کرده و به این ترتیب خود را در معرض بسیاری از بیماری‏ها‏ی مشترک باکتریایی، پروتوزوایی، قارچی، ویروسی یا انگلی قرار می‏‏دهند (1).

افزایش سویه‏ها‏ی مختلف باکتریایی مقاوم به آنتی‏بیوتیک‏ها‏ی مختلف تبدیل به یکی از نگرانی‏ها‏ی اصلی سازمان بهداشت جهانی شده است. به تازگی مقاومت باکتریایی که از طریق تولید بتالاکتامازهای با طیف گسترده در حال افزایش است، به عنوان یک مشکل درمانی جهانی مطرح شده است (2- 4). مطالعات زیادی در مورد وضعیت مقاومت آنتی بیوتیکی اشریشیا‏کلی انجام شده است که انتقال کمابیش سریع ژن‏ها‏ی مقاومت آنتی بیوتیکی بین سویه‏ها‏ (به ویژه با سرآغاز پلاسمیدی) را نشان می‏‏دهند (5 و 6). میزان مقاومت آنتی بیوتیکی در اشریشیا کلی به نقطه ای رسیده است که به عنوان چالش جدی درمانگاهی در انسان مطرح شده است.

اشریشیا کلی، شایع‏ترین میکروارگانیسم فلور لوله گوارش انسان و سایر حیوانات است ولی چند نوع بیماری‏زای آن بیماری‏ها‏ی مختلفی را در انسان ایجاد می‏کنند. در دهه گذشته عفونت ناشی از اشریشیا‏کلیO157 به عنوان یک بیماری نوپدید مشترک بین انسان و حیوان در آمریکای شمالی، اروپا و سایر نقاط دنیا مشکلات بهداشتی زیادی به بار آورده است و هرچند تعداد بیماران نسبت به عوامل بیماری‏زای روده ای دیگر نظیر سالمونلا یا کمپیلوباکتر خیلی کمتر است ولی مشخص شده که E. coli می‏تواند بیماری شدید و مرگ آور ایجاد نماید. این ارگانیسم برای نخستین بار در سال 1982 یعنی زمانی که باعث بروز دو اپیدمی کولیت هموراژیک با علائم کرامپ‏ها‏ی شکمی، اسهای آبکی بدون تب یا با تب خفیف شد، به عنوان عامل بیماری‏زای انسانی شناخته شد. در سال 1983، کارمالی و همکارانش[1] (7) ارتباط بین عفونت با نوعی E. coli را نشان دادند. این نوعی E. coli توکسین شیگا تولید می‏کند (ازجمله اشریشیا‏کلی O157:H7) و سندروم همولیتیک اورمیک پس از اسهال را که با آسیب حاد کلیوی، ترومبوستیوپنی و آنمی همولیتیک میکروآنژیوپاتیک همراه است (8). مطالعات زیادی که در زمینه بررسی آلودگی پرندگان از نظر آلودگی به اشریشیا کلی O157:H7 در نقاط مختلف دنیا انجام شده است نشان دهنده شیوع متفاوت اشریشیا کلی O157:H7 در پرندگان مناطق مختلف بوده است (9- 16).

در مطالعات انجام شده نشان داده شده است که در حیوانات اهلی و وحشی در تماس با فعالیت‏ها‏ی انسانی، مقاومت آنتی بیوتیکی مشابه وجود دارد (6 و 17). مطالعاتی که در زمینه بررسی آلودگی پرندگان مختلف از نظر آلودگی به اشریشیا کلی‏ها‏ی مقاوم به آنتی‏بیوتیکدر نقاط مختلف دنیا انجام شده است نشان دهنده شیوع متفاوت اشریشیا کلی در مناطق مختلف بوده است (18- 25). بنابراین، با توجه به اینکه پرندگان زینتی نیز می‏‏توانند به عنوان مخزنی برای ایجاد اشریشیا کلی‏ها‏ی جدید دارای ژن‏ها‏ی مقاومت آنتی بیوتیکی به ویژه ژن‏ها‏ی کد کننده ی بتالاکتازمازهای با طیف گسترده عمل کنند و در انتقال این مقاومت به انسان نقش داشته باشند، داشتن اطلاعات از وضعیت مقاومت داروئی در پرندگان زینتی و نقش آن‏ها‏ در انتقال مقاومت داروئی به انسان ضروری به نظر می‏‏رسد.

پرندگان ممکن است میکروب‏ها‏ی بیماری‏زا را از روده‏ها‏ی خود به زنجیره غذایی منتقل کنند. برای مثال پرندگان به محیط‏ها‏ی فراوری مواد غذایی وارد می‏‏شوند ویا می‏‏توانند سبزیجاتی که در محیط‏ها‏ی باز رشد می‏‏کنند و غذاهایی که در بازار آزاد فروخته می‏‏شوند را آلوده نمایند. همچنین، پرندگان خانگی نیز به صورت بالقوه می‏‏توانند میکروب‏ها‏ی بیماری‏زا را در خود جای داده و به صاحبان خود منتقل کنند (1).

با توجه به علاقه بسیاری از مردم در نگه داری از پرندگان زینتی، همچنین امکان انتقال عوامل بیماری‏زا از قبیل اشریشیا کلی O157:H7 توسط پرندگان زینتی و این‏که اطلاعات چندانی در مورد وضعیت مقاومت داروئی در پرنگان زینتی در کشور در دست نیست، نقش احتمالی پرندگان زینتی در انتشار و انتقال اشریشیا‏کلی‏ها‏ی مقاوم به آنتی بیوتیک به انسان در این منطقه در هاله ای از ابهام باقی مانده است. در این مطالعه با مطالعه بر روی پرندگان زینتی شهرکرد، به بررسی مقاومت به آنتی بیوتیک‏ها‏ی بتالاکتام در جدایه‏ها‏ی اشریشیا کلی و جستجوی مولکولی اشریشیا کلی O157:H7 به عنوان مهمترین عامل ایجاد اسهال به همراه خون‏ریزی در میان سروتیپ‏ها‏ی مختلف اشریشیا‏کلی در انسان، پرداخته شد.

مواد و روش‏ها

جمع آوری نمونه

در این مطالعه که در زمستان سال 1389 و بهار سال 1390 انجام شد در مجموع 256 نمونه مدفوعی از پرندگان زینتی از نقاط مختلف شهرکرد به وسیله ی سواب استریل جمع آوری شد.

جداسازی اشریشیا کلی

 سواب‏ها‏ مستقیما در محیط آبگوشت تریپتون سوی[2] (TSB) (مرک[3]، ساخت آلمان) قرار داده شدند و در آزمایشگاه بر روی محیط‏ها‏ی مکانکی آگار و سوربیتول مکانکی آگار (مرک، ساخت آلمان) به منظور ردیابی اشریشیا کلی و اشریشیا کلی O157 کشت داده و به مدت 24 ساعت در دمای 37 درجه سانتی گراد انکوبه شدند. پرگنه‏ها‏ی مشکوک جدا شده در محیط TSB کشت داده شدند و آزمون‏ها‏ی اندول، متیل رد، وگس پروسکوئر و سیترات (IMViC) بر روی نمونه‏ها‏ی مشکوک انجام شد.

آزمون آنتی بیوگرام

جدایه‏ها‏ی اشریشیا کلی پس از کشت در محیط مولر هینتون آگار (مرک، ساخت آلمان)، برای تعیین میزان مقاومت به آنتی بیوتیک‏ها‏ی بتالاکتام با استفاده از آنتی بیوتیک‏ها‏ی ایمیپنم، سفوتاکسیم، سفیکسیم، سفالکسین، آموکسی سیلین، پنی سیلین جی و اگزاسیلین (پادتن طب، ایران) آزمایش شدند.

جست و جوی اشریشیا کلی O157:H7

کنترل مثبت اشریشیاکلی O157:H7 از کلکسیون باکتری‏ها‏ی گروه بهداشت و کنترل کیفی مواد غذایی دانشکده دامپزشکی دانشگاه شهرکرد تهیه شد. برای جست و جوی اشریشیاکلی O157:H7 به وسیله PCR با استفاده از پرایمرهای درج شده در جدول 1 که قبلا توسط پاتون و پاتون[4] و گانون و همکاران[5] به ثبت رسیده اند آزمون شدند (26 و 27). PCR در حجم 25 میکرولیتر (5/2 میکرولیتر بافر10X PCR، 5/1 میکرولیتر کلرید منیزیم 50 میلی‏مولار، 1 میکرولیتر دزوکسی نوکلئوتید تری فسفات 10 میلی‏مولار، 5/1 واحد آنزیم Taq پلی مراز، 1 میکرولیتر با غلظت 10 میکرومولار از هر پرایمر، 1 میکرولیتر DNA الگو) انجام شد. دماهای استفاده شده در جدول 1 درج شده است. در پایان محصولات PCR روی ژل آگاروز 5/1 درصد الکتروفورز شد.

 

 

جدول 1- مشخصات پرایمرهای استفاده شده (26 و 27)

پرایمرها

گسترش

دمای Annealing

واسرشت

سیکل

توالی پرایمرها

اندازه محصول

منبع

O157

72 درجه سانتی‏گراد

60 ثانیه

55  درجه سانتی‏گراد

60 ثانیه

94 درجه سانتی‏گراد

60 ثانیه

35

F: 5´ CGGACATCCATGTGATATGG 3´

R: 5´ TTGCCTATGTACAGCTAATCC 3´

259

جفت باز

26

fliC H7

72 درجه سانتی‏گراد

60 ثانیه

60 درجه سانتی‏گراد

65 ثانیه

94 درجه سانتی‏گراد

60 ثانیه

35

F: 5´ GCGCTGTCGAGTTCTATCGAGC 3´

R: 5´ CAACGGTGACTTTATCGCCATTCC 3´

625

جفت باز

27

 


تحلیل آماری

نتایج به دست آمده با استفاده از آزمون مربع کای (X2) و با استفاده از نرم افزار آماری SPSS14، تجزیه و تحلیل شدند.

نتایج

میزان آلودگی به اشریشیا کلی در پرندگان زینتی 1/12 درصد (31 از 256 نمونه) بود (جدول2). در میان پرندگان مختلف میزان آلودگی به اشریشیا کلی در طاووس به میزان چشمگیری بیشتر از سایرین بود (جدول 2). میزان مقاومت جدایه‏ها‏ی اشریشیا کلی به آنتی بیوتیک‏ها‏ی ایمیپنم، سفوتاکسیم، سفیکسیم، سفالکسین، آموکسی سیلین، پنی‏سیلین جی و اگزاسیلین به ترتیب صفر، 2/3، 1/16، 3/90، 100، 100 و 100 درصد بود. در هیچ کدام از نمونه‏ها‏ اشریشیا کلی O157:H7 یافت نشد.

 

شکل1- تصویر الکتروفورز ژل آگاروز کنترل مثبت اشریشیاکلی O157:H7. M: مارکر100 جفت بازی، NC: کنترل منفی،
 PC1: کنترل مثبت O157، PC2: کنترل مثبت H7


 

جدول2- مشخصات پرنده‏ها‏ی آزمایش شده

نام پرنده

تعداد

جدایه‏ها‏ی اشریشیاکلی

فصل نمونه گیری

مقاوم به سفوتاکسیم و سفیکسیم (سفالوسپورین‏ها‏ی نسل سوم)

نام پرنده

تعداد

جدایه‏ها‏ی اشریشیاکلی

فصل نمونه گیری

مقاوم به سفوتاکسیم و سفیکسیم (سفالوسپورین‏ها‏ی نسل سوم)

 

تعداد

درصد

تعداد

درصد

 

تعداد

درصد

تعداد

درصد

 

مرغ عشق

153

صفر

صفر

بهار

-

-

طاووس

8

5

5/62

زمستان

-

-

 

بلبل

25

9

36

زمستان

1

4

فینچ

6

صفر

صفر

زمستان

-

-

 

طوطی

31

3

67/9

زمستان

1

2/3

مرغ بهشتی

1

صفر

صفر

زمستان

-

-

 

مینا

12

7

33/58

زمستان

1

3/8

بلدرچین

1

صفر

صفر

زمستان

-

-

 

قرقاول

8

4

50

زمستان

2

25

-

-

-

-

-

-

-

 

سهره

11

3

27/27

زمستان

-

-

مجموع

256

31

1/12

 

5

1/16

 

 

 

کم اثرترین آنتی بیوتیک‏ها‏ آموکسی سیلین، پنی‏سیلین جی و اگزاسیلین بودند که تمامی جدایه‏ها‏ی اشریشیا کلی به آن‏ها‏ 100 درصد مقاوم بودند. موثرترین آنتی بیوتیک ایمیپنم بود که نسبت به آن هیچ گونه مقاومتی مشاهده نشد. 1/16 درصد (5 از 31) از جدایه‏ها‏ به سفوتاکسیم و سفیکسیم (سفالوسپورین‏ها‏ی نسل سوم) مقاوم بودند.

 

بحث و نتیجه­گیری

روند تولید آنتی بیوتیک‏ها‏ی جدید در بازارهای جهانی بسیار کمتر از داروهای قلبی عروقی، اعصاب و روان و حتی داروهای شیمی درمانی است و شرکت‏ها‏ی دارویی تمایل چندانی برای سرمایه گذاری روی آنتی‏بیوتیک‏ها‏ ندارند زیرا دوره مصرف آنتی بیوتیک‏ها‏ محدود بوده و دارای هزینه‏ها‏ی بسیار بالا در تولید هستند. مصرف بی رویه آنتی بیوتیک‏ها‏ علاوه بر صرف هزینه‏ها‏ی بالا و تحمیل عوارض، یکی از مهم‏ترین مشکلات یعنی مقاومت‏ها‏ی میکروبی را ایجاد می‏‏کند. با توجه به این‏که پرندگان زینتی به صورت بالقوه می‏‏توانند در انتشار و انتقال اشریشیا کلی‏ها‏ی مقاوم به آنتی‏بیوتیک به انسان نقش داشته باشند، اطلاع از وضعیت مقاومت‏ها‏ی میکروبی در پرندگان زینتی و همچنین، جلوگیری از مصرف بی رویه آنتی‏بیوتیک‏ها‏ در درمان و یا پیشگیری از بیماری در این پرنده‏ها‏ ضروری به نظر می‏‏رسد.

در مطالعات انجام شده در نقاط مختلف دنیا وضعیت مقاومت آنتی‏بیوتیکی در پرندگان مختلف متفاوت بوده است، به نحوی که در بعضی از مطالعات میزان بسیار بالایی از مقاومت آنتی بیوتیکی (18) و در بعضی دیگر شیوع پایین تری گزارش شده است (19- 25).

در مطالعه ای که توسط عسکر و همکاران[vi] روی کبوترهای خانگی در ترکیه انجام شد میزان بالایی از مقاومت آنتی بیوتیکی گزارش شد، بیشترین مقاومت جدایه‏ها‏ی اشریشیا کلی در برابر آمپی سیلین- سولباکتام (70 درصد)، اکسی تتراسایکلین (64 درصد) و نالیدیکسیک اسید (49 درصد) مشاهده شد (18). سیلوا و همکاران[vii] در مطالعه ای که در برزیل روی جدایه‏ها‏ی اشریشیا کلی ایجاد کننده ی اسهال جدا شده از کبوترهای شهری انجام دادند، به این نتیجه رسیدند که 9/37 درصد از آن‏ها‏ نسبت به حداقل یکی از آنتی‏بیوتیک‏ها‏ی آزمایش شده مقاوم بودند. در این میان آمیکاسین با 8/36 درصد مقاومت دارای کمترین مقاومت بود. اما خلاف مطالعه ی ما که نسبت به سفالوسپورین‏ها‏ی نسل سوم 1/16 درصد مقاومت وجود داشت، در مطالعه ی سیلوا و همکاران نسبت به سفتریاکسون و سفتازیدیم (سفالوسپورین‏ها‏ی نسل سوم) هیچ مقاومتی دیده نشد (19). در گزارشی دیگر در اشریشیا کلی‏ها‏ی جدا شده از کبوترهای چکوسلواکی 5/1 درصد مقاومت آنتی بیوتیکی مشاهده شد (20). دولجسکا و همکاران[viii] در مطالعه‏ای که روی اشریشیا کلی‏ها‏ی جدا شده از مرغ نوروزی سر سیاه انجام دادند اعلام کردند که 9/29 درصد از گونه‏ها‏ی اشریشیا کلی جدا شده نسبت به آنتی بیوتیک‏ها‏ مقاوم بودند. همه گونه‏ها‏یی که مقاومت در آن‏ها‏ ایجاد شده بود حداقل به یک آنتی بیوتیک یا بیشتر مقاوم بودند. در میان آنتی‏بیوتیک‏ها‏ی آزمون شده، بیشترین مقاومت نسبت به تتراسایکلین (1/19درصد) و کمترین مقاومت نسبت به کلرامفنیکل (9/1 درصد) وجود داشت (21). در مطالعه دیگر که در شمال شرقی چکوسلواکی انجام شد 28 درصد از اشریشیا کلی‏ها‏ی جدا شده از مرغ نوروزی نسبت به آنتی بیوتیک‏ها‏ مقاوم بودند. در میان آنتی‏بیوتیک‏ها‏ی آزمون شده، بیشترین مقاومت نسبت به تتراسایکلین (22 درصد) وجود داشت اما خلاف مطالعه ما نسبت به سفتریاکسون و سفتازیدیم (سفالوسپورین‏ها‏ی نسل سوم) هیچ مقاومتی دیده نشد (22). در مطالعه ای که در فرانسه بر روی انتقال اشریشیا کلی‏ها‏ی تولیدکننده ی بتلاکتاماز بین انسان و مرغ نوروزی پنجه زرد انجام شد، اعلام شد که 1/47 درصد از ایزوله‏ها‏ حداقل به یک آنتی بیوتیک یا بیشتر مقاوم بودند. بیشترین مقاومت نسبت به تتراسایکلین و کمترین مقاومت نسبت به نالیدیکسیک و کلرامفنیکل وجود داشت (23). در مطالعه ای که در آلمان بر روی مرغابی وحشی انجام شد در جدایه‏ها‏ی اشریشیا کلی بیشترین مقاومت نسبت به آموکسی سیلین، آمپی سیلین، تتراسایکلین و سولفونامیدها گزارش شد (24). لیتراک و همکاران[ix] در مطالعه ای که روی اشریشیا کلی‏ها‏ی مقاوم در برابر آنتی بیوتیک جدا شده از کلاغ‏ها‏ی روسی انجام دادند، مشاهده کردند که 7/13 درصد از ایزوله‏ها‏ به آنتی بیوتیک‏ها‏ی آزمایش شده مقاوم بودند و بیشترین مقاومت در برابر تتراسایکلین وجود داشت (6/7درصد نمونه‏ها‏) و هیچ کدام از نمونه‏ها‏ی جداشده اشریشیا کلی نسبت به سفالوتین، سفتازیدیم و سفتریاکسون مقاوم نبودند (25).

در این مطالعه، اشریشیا کلی‏ها‏یی که از پرندگان زینتی جداسازی شد مقاومت بالای آنتی بیوتیکی را نشان داد. بیشتر جدایه‏ها‏ مقاومت به چندین آنتی بیوتیک را از خود نشان دادند. این مسئله احتمال اینکه این پرندگان به عنوان مخزن باکتری مقاوم به ضد میکروب‏ها‏ و یا ژن‏ها‏ی کد کننده ی بتالاکتامازهای مختلف عمل کنند را به میزان زیادی افزایش می‏‏دهد. این جدایه‏ها‏ی مقاوم، به عنوان مشکلی جدی می‏‏توانند مطرح باشند چون گزینه‏ها‏ی درمانی علیه عفونت‏ها‏ی انسانی و حیوانی را به شدت محدود می‏‏کنند (28).

این مطالعه نشان می‏‏دهد که پرندگان زینتی با اشریشیا کلی‏ها‏ی مقاوم به آنتی بیوتیک‏ها‏ی بتالاکتام می‏‏توانند آلوده شوند. این مسئله می‏‏تواند بازتاب تماس مستقیم یا غیر مستقیم با فعالیت‏ها‏ی انسانی در منطقه ای با مصرف کمابیش بالای آنتی بیوتیک و استفاده بدون نظارت و بی رویه از آنتی بیوتیک‏ها‏ی مختلف برای درمان و یا پیشگیری از بیماری در این پرنده‏ها‏ باشد؛ و یا نشان دهنده حضور چنین جدایه‏ها‏یی در غذا یا آبی است که از آن تغذیه می‏‏کنند. البته شایان ذکر است که صاحبان پرنده‏ها‏ نیز اظهار داشتند که بدون نظارت دامپزشک از آنتی بیوتیک‏ها‏ی مختلف استفاده کرده‏اند.

اشریشیا کلی O157:H7 برجسته ترین و نخستین سروتیپ شناخته شده در تحت گروه اشریشیا کلی خونریزی دهنده روده ای و عامل کولیت خونریزی دهنده و سندرم اورمی همولیتیک است‏‏. این باکتری از جمله باکتری‏ها‏یی است که توجه محققان و دست‏اندرکاران بهداشتی را به خود معطوف کرده است. با توجه به اینکه عامل اصلی انتشار و مخزن اصلی اشریشیاکلیO157:H7، گاو و محصولات غذایی با این سرآغاز است بیشتر مطالعات و گزارش‏ها‏ی موجود به آلودگی این محصولات مربوط بوده است(29- 31). شیوع این پاتوژن در گوشت و محصولات حاصل از گوشت گاو بین 1 تا 8/27 درصد گزارش شده است (30).

مطالعات مختلف نتایج متفاوتی را از میزان شیوع سروتیپ اشریشیا کلی O157:H7 در پرندگان نشان می‏‏دهند. چنانچه در مطالعه ی سانتانیلو و همکاران[x] 504 نمونه سواب کلواک کبوتر از شهر ناپولی[xi] واقع در ایتالیا جمع آوری شد که در این بین 4 نمونه آلوده به O157:H7 یافت شد (10). همچنین شر و همکاران[xii] از 99 پرنده مورد بررسی در حوالی کارخانه‏ها‏ی تولید کننده مواد لبنی در ایالت ویسکونسین[xiii] آمریکا، در یک کبوتر آلودگی به O157:H7 یافتند (11). در مطالعه دیگر در استان فوجیان[xiv] واقع در چین شیوع O157 در حیوانات مختلف بررسی شد، طی این تحقیق این پاتوژن از کبوتر نیز جداسازی شد (12). در مطالعه ی لجئونو همکاران[xv] بر روی پرستوهای اروپایی میزان 3 درصد از نمونه‏ها‏ به O157:H7 آلوده بودند (13).

اما مشابه با بعضی از مطالعات پیشین در ایران و سایر کشورها، نتایج این مطالعه نیز عدم وجود اشریشیا کلی O157:H7 را در پرندگان زینتی منطقه بررسی شده، نشان می‏‏دهد. برای مثال در مطالعه ای که توسط طهماسبی و همکاران[xvi] در پرندگان زینتی یزد انجام شد هیچ نمونه ی آلوده به اشریشیا کلی O157 یافت نشد (9). طی مطالعه ای که توسط مورابیتو و همکاران[xvii] در ایتالیا بر روی نمونه‏ها‏ی مدفوعی کبوتر انجام شد در 70 نمونه از 649 نمونه که بررسی شده بود، اشریشیا کلی شیگاتوکسین‏زا یافت شد اما سروتیپ اشریشیا کلی O157 در هیچ کدام یک از نمونه‏ها‏ی مورد بررسی یافت نشد (14). در مطالعه ای نیز که در ژاپن انجام شد 108 نمونه بررسی شد اما همه نمونه‏ها‏ نسبت به
اشریشیا کلی O157 منفی بودند (15) و طی تحقیقی که در سال 2009 روی پرستوهای وحشی اروپایی انجام شد نیز سروتیپ اشریشیا کلی O157 در هیچ کدام یک از نمونه‏ها‏ی مورد بررسی یافت نشد (16).

اگرچه در نمونه‏ها‏ی اخذ شده اشریشیا کلی O157:H7 یافت نشد، اما ممکن است سوش‌‏ها‏ی اسهال‌زای دیگری از اشریشیا کلی در میان نمونه‏ها‏ی این پرندگان وجود داشته باشد که در این زمینه بررسی‏ها‏ی بیشتر توصیه می‏شود‏‏.

مشابه با بعضی از مطالعات پیشین در ایران (9) و سایر کشورها (14 و 15)، نتایج این مطالعه نیز نبود اشریشیا کلی O157:H7 را در پرندگان زینتی این منطقه نشان می‏‏دهد. بنابراین به نظر می‏‏رسد که نمی‏‏توان پرندگان زینتی این منطقه را به عنوان منبع یا حامل اشریشیا کلی O157:H7 تلقی نمود.

سرد و خشک بودن آب و هوا بر کاهش بقای میکروب‏ها‏ بسیار موثر است و از علل میزان پایین آلودگی به اشریشیا کلی و به دنبال آن، عدم آلودگی به اشریشیا کلی O157:H7 در این مطالعه شاید بتوان این مسئله را ذکر کرد که مطالعه حاضر در فصل زمستان و بهار که شیوع میکروب‏ها‏ در آن کاهش می‏‏یابد انجام شده است. همچنین، از آن‏جایی که سطح بهداشتی وضعیت تغذیه ای و محیط زندگی در پرندگان زینتی نسبت به سایر پرندگان در میزان بالاتری قرار دارد ممکن است این مسئله بر نتایج به دست آمده در این مطالعه موثر بوده باشد.

با توجه به مقاومت بالای جدایه‏ها‏ی اشریشیا کلی در این مطالعه در برابر آنتی بیوتیک‏ها‏ی آزمون شده و خطر بالقوه‏ای که می‏‏تواند سلامت مردم را در اثر نگه داری از پرندگان زینتی تهدید کند، باید به صاحبان پرندگان زینتی و همچنین عموم مردم در مورد نحوه ارتباط با پرندگان زینتی و عدم استفاده بی رویه از آنتی بیوتیک‏ها‏ در درمان بیماری‏ها‏ی پرندگان زینتی، آموزش‏ها‏ی لازم داده شود و همچنین آن‏ها‏ را از خطرات احتمالی نگه‏داری از این پرنده‏ها‏ مطلع نمود. همچنین، اگرچه نمی‏‏توان پرندگان زینتی این منطقه را به عنوان منبع یا حامل اشریشیا کلی O157:H7 تلقی نمود اما ممکن است که پرندگان زینتی این منطقه، حامل سایر سوش‏ها‏ی بیماری‏زای اشریشیا کلی باشند که با توجه به این مسئله تحقیقات بیشتر در این زمینه توصیه می‏شود‏‏.



[1]. Karmali et al.

[2]. Trypton Soy Broth

[3]. Merck

[4]. Paton and Paton

[5]. Ganon et al.

[vi]. Aşkar et al.

[vii]. Silva et al.

[viii]. Dolejská et al.

[ix]. Literák et al.

[x]. Santaniello et al.

[xi]. Napoli

[xii]. Shere et al.

[xiii]. Wisconsin

[xiv]. Fujian

[xv]. LeJeune et al.

[xvi]. Tahmasby et al.

[xvii]. Morabito et al.

 

 
References

(1) Krauss H, Weber A, Appel M, Enders B, Isenberg HD, Schiefer HG, et al. Zoonoses: Infectious Diseases Transmissible From Animals to Humans, 3rd ed. Washington, DC: American Society for Microbiology Press, 2003.

(2) Bush K. Extended-spectrum b-lactamases in North America, 1987–2006. Clin Microbiol Infect 2008; 14 (1): 134–43.

(3) Canto´ R, Novais A, Valverde A, Machado E, Peixe L, Baquero F, et al. Prevalence and spread of extended-spectrum b-lactamase-producing Enterobacteriaceae in Europe. Clin Microbiol Infect 2008; 14 (1): 144–53.

(4) Hawkey PM. Prevalence and clonality of extendedspectrum b-lactamases in Asia. Clin Microbiol Infect 2008; 14 (1): 159–65.

(5) Bonnet R. Growing group of extended-spectrum beta-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother 2004; 48(1): 1-14.

(6) Sorum H, Sunde M. Resistance to antibiotics in the normal flora of animals. Vet Research 2001; 32(3-4): 227-41.

(7) Karmali MA, Steele BT, Petric M, Lim C. Sporadic cases of haemolyTic-uraemic sgndrome associated with faecal cytotoxin and cytotoxin-producing E. coli in stools. Lancet 1983; 19, 1(8325):619-20.

(8) Riley IW, Remis RS, Helgerson SD. Hemorrhagic colitis associated with a rare Escherichia coli serotype. New England J Med 1983; 308(12):681-85.

(9) Tahmasby H, Momtaz H, Salehi N, Rafiee Dolatabadi M, Yektaneh F. Prevalence of Escherichia Coli O157:H7 in pet birds in Yazd, Iran. Pajouhandeh 2011; 16(5): 252-5.

(10)            Santaniello A, Gargiulo A, Borrelli L, Dipineto L, Cuomo A, Sensale M, et al. Survey of Shiga toxin-producing Escherichia coli O157:H7 in urban pigeons (Columba livia) in the city of Napoli, Italy. Italian J Animal Sci 2007; 6(3): 313-16.

 

(11)            Shere JA, Bartlett KJ, Kaspar CW. Longitudinal Study of Escherichia coli O157:H7 Dissemination on Four Dairy Farms in Wisconsin. Appl Environ Microbiol 1998; 164(4): 390–99.

(12)            Chen K, Guo W, Cheng F, Lin C, Lin J, Dong X. Investigation on E. coli O157 in Fujian, China; Zhonghua Yu Fang Yi Xue Za Zhi 2000; 34(3):156-58.

(13)            LeJeune J, Homan J, Linz G, L. Pearl D. Role of the European Starling in the Transmission of E. coli O157 on Dairy Farms. Proceedings of the 23th Vertebrate Pest Conference. Published at University of California, Davis. 2008; 31-34.

(14)            Morabito S, Dell’Omo G, Agrimi U, Schmidt H, Karch H, Cheasty T, et al. Detection and characterization of Shiga toxinproducing Escherichia coli in feral pigeons. Vet Microbiol 2001; 82(3): 275- 83.

(15)            Tanaka C, Miyazawa T, Watarai M, Ishiguro N. Bacteriological survey of feces from feral pigeons in Japan; J Vet Med Sci 2005; 67 (9): 951-953.

(16)            Gaukler SM, Linz GM, Sherwood JS, Dyer NW, Bleier WJ, Wannemuehler YM, et al. Escherichia coli, Salmonella, and Mycobacterium avium subsp. paratuberculosis in Wild European Starlings at a Kansas Cattle Feedlot. Avian Dis 2009; 53(4): 544–51.

(17)            Costa D, Poeta P, Saenz Y, Vinue L, Rojo-Bezares B, Jouini A, et al. Detection of Escherichia coli harbouring extended-spectrum beta-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. J Antimicrob Chemother 2006; 58(6): 1311–12.

(18)            Aşkar Ş, Sakarya F, Yıldırım M. The Potential Risk in Epizootiology of Bacterial Zoonozis: Pigeon (Columba livia domestica) Feces. Kafkas Univ Vet Fak Derg 2011, 17: 13-16.

 

(19)             Silva VL, Nicoli JR, Nascimento TC, Diniz CG. Diarrheagenic Escherichia coli strains recovered from urban pigeons (Columba livia) in Brazil and their antimicrobial susceptibility patterns. Curr Microbiol. 2009; 59(3): 302-8.

(20)             Radimersky T, Frolkova P, Janoszowska D, Dolejska M, Svec P, Roubalova E, et al. Antibiotic resistance in faecal bacteria (Escherichia coli, Enterococcus spp.) in feral pigeons. J Appl Microbiol 2010; 109(5): 1687- 95.

(21)             Dolejská M, Cízek A, Literák I. High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from Black-headed Gulls in the Czech Republic. J Appl Microbiol 2007; 103(1): 11-9.

(22)             Dolejská M, Bierosová B, Kohoutová L, Literák I, Cízek A. Antibiotic-resistant Salmonella and Escherichia coli isolates with integrons and extended-spectrum beta-lactamases in surface water and sympatric black-headed gulls. J Appl Microbiol 2009; 106(6): 1941-50.

(23)             Bonnedahl J, Drobni M, Gauthier-Clerc M, Hernandez J, Granholm S, Kayser Y, et al. Dissemination of Escherichia coli with CTX-M Type ESBL between Humans and Yellow-Legged Gulls in the South of France. PLoS One 2009 18;4(6):e5958.

(24)             Ewers C, Guenther S, Wieler LH, Schierack P. Mallard ducks – a waterfowl species with high risk of distributing Escherichia coli pathogenic for humans. Environ Microbiol Rep 2009; 1(6): 510–17.

(25)             Literák I, Vanko R, Dolejská M, Cízek A, Karpísková R. Antibiotic resistant Escherichia coli and Salmonella in Russian rooks (Corvus frugilegus) wintering in the Czech Republic. Lett Appl Microbiol 2007; 45(6): 616-21.

(26)             Paton AW and Paton JC. Detection an characterization of shiga toxigenic Escherichia coli by using multiplex PCR assay for stx1, stx2, eae A, enterohemorrhagic E. coli hlyA, rfbO111 and rfbO157. J Clin Microbiol 1998; 36(2): 598-602.

(27)             Ganon VP, D'Souza S, Graham T, King RK, Red S. Use of the flagellar H7 genes as a target in multiplex PCR assay and improved specificity in identification of enterohemorrhagic E. coli strains; J Clin Microbiol 1997; 35 (3): 656-62.

(28)            Rice LB. The clinical consequences of antimicrobial resistance. Curr Opin Microbiol 2009; 12(5):476–81.

(29)            Elder RO, Keen JE, Siragusa GR, Barkocy-Gallagher GA, Koohmaraie M. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides and carcasses of beet cattle during processing. Natl Acad Sci 2000; 28; 97(7): 2999-3003.

(30)            Reid CA, Small SM, Avery S, Buncic S. Presence of food borne pathagens on cattle hides. Food Control 2002; 13 (6-7): 411-15.

(31)            Stampi S, Caprioli A, De Luca G, Quaglio P, Sacchetti R. Detection of Escherichia coli O157 in bovine meat products in northern Italy. Int J Food Microbiol 2004; 1; 90(3):257-62.