تشخیص مقاومت به افلوکساسین با روش مولکولی سریع Allele Specific PCR ‏در مایکوباکتریوم توبرکلوزیس

نویسندگان

1 دانشجوی کارشناسی ارشد میکروبیولوژی، ‏‏‏‏دانشگاه آزاد اسلامی، واحد قم، گروه میکروبیولوژی، قم، ‏ایران

2 استادیار میکروبیولوژی، ‏‏دانشگاه آزاد اسلامی، واحد قم، گروه میکروبیولوژی، قم، ‏ایران

3 دانشجوی دکتری تخصصی ژنتیک مولکولی، دانشگاه تربیت مدرس و مرکز تحقیقات سل و عفونی کودکان، علوم پزشکی اراک،ایران

4 دانشجوی دکتری تخصصی پزشکی مولکولی، مرکز تحقیقات پزشکی و مولکولی، دانشگاه علوم پزشکی اراک، ایران

5 استادیار ‏مرکز تحقیقات سل و ریه، دانشگاه علوم پزشکی تبریز، ایران

6 استادیار باکتری شناسی پزشکی، مرکز تحقیقات سل و عفونی کودکان، دانشگاه علوم پزشکی اراک، ایران

چکیده

  مقدمه : مقاومت به فلوروکینولون‏ها در بیماری سل رو به گسترش است. ‏تشخیص مقاومت به روش کشت خلط دو ماه به طول می‏انجامد. ‏مطالعه حاضر، به منظور طراحی روشی برای تشخیص سریع مقاومت سویه ‏ها ی کلینیکی مایکوباکتریوم توبرکلوزیس به افلوکساسین انجام شد.   مواد و روش‏‏ها: در این مطالعه، ‏ DNA ‏های استخراج شده از 41 سویه کلینیکی مایکوباکتریوم توبرکلوزیس ‏حساس و مقاوم ‏به افلوکساسین موجود در بانک DNA مرکز تحقیقات سل و بیماری‏های عفونی با دو روش مولکولیآلل اسپسیفیک پی سی آر ( AS-PCR ) و تعیین ترادف (سکوئنس)، برای تعیین موتاسیون در منطقه مرتبط با مقاومت ژن gyrA با هم مقایسه شدند. ‏پرایمرهای داخلی برای تشخیص موتاسیون‏های مرتبط با مقاومت طراحی و شرایط ‏ PCR ‏تعیین شد‏. ‏قطعه مورد نظر درتعدادی از نمونه‏ها تعیین ترادف شده و به‏عنوان استاندارد طلایی با روش‏های ارائه شده مقایسه شد.   نتایج: روش AS-PCR ‏به خوبی قادر به تشخیص موتاسیون با تشکیل یا عدم تشکیل باند داخلی شد‏ که نشان دهنده طراحی صحیح پرایمرها بود. ‏روش AS-PCR اجرا و با توجه به نتایج بسیار خوب به عنوان روش عادی استفاده شد. ‏در مجموع، ‏از 41 سویه کلونیکی مایکوباکتریوم توبرکلوزیس مطالعه شده، ‏37 سویه از نظر فنوتیپی (‏به روش کشت proportion ) مقاوم به افلوکساسین و 4 سویه حساس به این دارو بودند. ‏از 37 سویه مقاوم از نظر فنوتیپی، 32سویه با روش AS-PCR مقاوم به افلوکساسین و 5 نمونه حساس تعیین شدند. ‏نتایج تعیین ترادف، ‏با نتایج روش‏های استفاده شده انطباق داشت. ‏حساسیت و ویژگی روش به ترتیب ‏معادل ‏11/86 درصد و 100 درصد به دست آمد.   بحث و نتیجه‏گیری: نتایج مطالعه حاضر نشان می‏دهد که روش AS-PCR طراحی شده می‏تواند به عنوان یک روش ساده و سریع برای تعیین حساسیت و مقاومت به افلوکساسین در سویه‏های مایکوباکتریوم توبرکلوزیس استفاده شود. ‏این روش تا کنون در منابع علمی گزارش نشده است.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Allele Specific-PCR method for rapid detection of gyrA gene mutaions in clinical isolates of Mycobacterium tuberculosis

نویسندگان [English]

  • vahide vahidi 1
  • Mohammad Reza Zolfaghari 2
  • azam Ahmadi 3
  • mana shojapour 4
  • seyed Reza Moaddab 5
  • Mohammad Arjomandzadegan 6
1 MSc Student of Microbiology,Department of microbiology, Qom Branch, Islamic Azad University, Qom, Iran
2 Assistant Professor of Microbiology,Department of microbiology, Qom Branch, Islamic Azad University, Qom, Iran
3 Ph.D student of Molecular Genetics, TMU and Tuberculosis and Pediatric Infectious Disease Research Center , ArakUniversity of Medical Sciences, Arak, Iran
4 Ph.D student of Molecular Medicine, Research Center of Molecular Medicine, University of Medical Sciences, Arak, Iran
5 Assistant Professor of TB and Pulmonary Diseases research center, Tabriz University of Medical Sciences, Iran
6 Assistant Professor of Medical Bacteriology, University of Medical Sciences, Arak, Iran
چکیده [English]

  Introduction : Resistance to Fluroquinolones drugs are increasingly expanded. A molecular method was designed and compared for rapid detection of resistance to ofloxacin in clinical isolates of Mycobacterium tuberculosis .   Materials and method s: From 136 M. tuberculosis clinical isolates, 41 strains were used for comparison of detection of mutations associated with resistance in gyrA gene by Allele Specific-PCR (AS PCR) . Specific i nternal primers were designed for detecting any changes in 90, 91 and 94 codons. Sequencing method was accomplished for evaluation of the results as gold standard .   Results : AS-PCR method could detect mutations by formation or not formation of internal bounds and had good performance. Totally, from 37 strains phenotypically resistant to ofloxacine 32 strains were mutant and 5 strains were non mutant that have Sensitivity and specificity, 86/11% and 100%, respectively. Sequence results were concordant by results molecular methods .   Discussion and conclusion : Results of the study showed that AS-PCR method could be used as a routine test for fast detection of resistance to fluroquinolones in M. tuberculosis .  

کلیدواژه‌ها [English]

  • Mycobacterium Tuberculosis
  • Allele Specific-PCR
  • Ofloxacin

مقدمه

امروزه یکی از بزرگ‏ترین مسائل بهداشتی جهان، ‏بیماری سل است. ‏حدس زده می‏شود که از هر سه نفر جمعیت جهان، ‏یک نفر به باسیل سل آلوده بوده و در هر ثانیه یک نفر به تعداد آنان افزوده می‏شود. ‏طبق برآوردهای موجود، 50 میلیون نفر از این افراد، ‏به باسیل سل مقاوم به چند دارو ‏(‏MDR-TB) آلوده هستند و این مساله به شدت نگران کننده است (‏1). ‏در سال‏های اخیر بروز گسترش سل مقاوم به دارو و همچنین، مقاومت به فلوروکینولون‏ها و البته مقاومت به یکی از داروهای تزریقی نگرانی‏های زیادی در کنترل سل به وجود آورده است ‏(‏4). ‏درمان نامناسب بیماران TB، به موتاسیون در سویه‏های مایکوباکتریوم توبرکلوزیس منجر خواهد شد که سببب مقاومت دارویی می‏شود ‏(‏5). ‏تجمع موتاسیون در ژن‏های هدف سبب ایجاد سویه‏های MDR-TB و XDR-TB می‏شود ‏(‏2). ‏از این رو تشخیص سریع مقاومت نکته کلیدی در کنترل و درمان سل است ‏(‏1). ‏هدف سلولی فلوروکینولون‏ها در مایکوباکتریوم توبرکلوزیس، آنزیم DNAgyrase است که پیچش DNA را هنگام همانندسازی باز می‏کند تا همانند‏سازی DNA انجام گیرد (‏5 و 6). ‏این آنزیم شامل دو زیر واحد آلفا و بتا است که زیر واحد آلفا توسط ژن gyrA و زیرواحد بتا توسط ژن gyrB کد می‏شوند. ‏با توجه به مطالعاتی که تاکنون بر روی مقاومت به فلوروکینولون‏ها در مایکوباکتریوم توبرکلوزیس انجام شده، مشخص شده که مقاومت به این دارو وابسته به موتاسیون در یکی از کدون‏های ‏منطقه QRDR، ژن gyrA کد کننده زیر واحد آلفای آنزیم DNAgyrase است (‏5- 7) ‏تحلیل ناحیه QRDR به تنهایی از طریق آزمایش‏های ژنوتایپینگ انجام می‏شود که این آزمایش‏ها به عنوان آزمایش‏های سریع شناسایی، شناخته شده اند. ‏تا کنون برای تعیین رخداد جهش‏‏ها در ناحیه QRDR از کدون 89 تا 94 از روش‏های تعیین ترادف، real-time PCR و SSCP استفاده شده است (‏5، 6، 8-10). ‏

حالت وحشی[1] به عنوان شاخص در نظر گرفته شده و هر گونه حالت غیر طبیعی به عنوان موتان در نظر گرفته می‏شود. ‏به این ترتیب فارغ از نوع موتاسیون و تبدیل اسید آمینه ‏ASP به هر اسید آمینه دیگردر کدون 94 پرایمرهایی برای حالت وحشی طراحی شده که تمام انواع موتاسیون‏های احتمالی شناخته شده یا نشده را پوششش می‏دهد. ‏

از آن‏جایی که افلوکساسین، یکی از داروهای رده دوم درمان سل است که امروزه به شکل گسترده برای درمان سل مقاوم به چند دارو استفاده می‏شود، متاسفانه به علت مصرف فراوان و نامنظم دارو، مقاومت اکتسابی به این دارو، رو به افزایش است. ‏بنابراین، پیدا کردن روش سریع برای تشخیص مقاومت فرد مبتلا به این دارو، بسیار مهم است. ‏روش ‏‏AS-PCR یک تکنیک مناسب برای تشخیص موتاسیون‏های نقطه ای یا حذف‏های کوچک است. ‏این روش نوعی از PCR است که در آن علاوه بر پرایمرهای رفت و برگشت، ‏یک پرایمر داخلی نیز استفاده می‏شود. ‏طراحی این پرایمر داخلی کاملا اختصاصی بوده و مبتنی بر شناخت موتاسیون‏های احتمالی در سایت مورد نظر است. ‏با این توضیح که منطقه ای از پرایمر که باید کاملامنطبق با الگو باشد، ‏انتهای 3′ است. ‏پرایمر از قسمت 3′ به محل اختصاصی خود در الگو متصل شده و طویل شدن پرایمر ‏(‏تشکیل رشته جدید) از همین بخش توسط DNA پلی‏مراز انجام می‏شود. ‏پرایمر به گونه‏ای طراحی می‏شود که محل موتاسیون احتمالی در محل اتصال 3′پرایمر به الگو باشد. ‏بدین ترتیب در صورت رخداد موتاسیون در این نقطه، ‏پرایمر متصل نشده و باند تشکیل نمی‏شود.

 ‏این تحقیق، ‏با هدف دستیابی به روشی ساده به منظور تشخیص مقاومت سویه‏های کلینیکی مایکوباکتریوم توبرکلوزیس به فلوروکینولون‏ها، بدون نیاز به دستگاه‏های پیشرفته و روش‏‏های زمان‏بر انجام شد‏ه است.

مواد و روش‏ها

در این تحقیق، ‏DNA‏‏‏های استخراج شده از 41 سویه کلینیکی مایکوباکتریوم توبرکلوزیس ‏حساس و مقاوم ‏به افلوکساسین موجود در بانک DNA مرکز تحقیقات سل و بیماری‏‏های عفونی با دو روش مولکولی
 AS-PCR و تعیین ترادف، برای تعیین موتاسیون در منطقه مرتبط با مقاومت ژن gyrA با هم مقایسه شدند. ‏از این میان 37 سویه از نظر فنوتیپی مقاوم و 4 سویه حساس به افلوکساسین بودند.


طراحی پرایمر

بدین منظور از Gene Blast و نرم افزار‏های ‏Mega و Integrated DNA Technology استفاده شد (‏جدول2). ‏

انجام PCR

به منظور بررسی وجود موتاسیون در ژن gyrA و به منظور تکثیر قطعه 194bp، ‏DNA استخراج شده به همراه پرایمر‏های اختصاصی F و R ‏(‏جدول 2)‏ در واکنش PCR وارد شد‏ه و تکثیر بخش مورد نظر از ژن یاد شده در دستگاه ترموسایکلر انجام شد. ‏واکنش PCR ‏با تغییر دمای اتصال پرایمر‏ها Annealing و غلظت آن‏ها‏ بهینه شد (‏جدول ‏1).

 

جدول1- ‏برنامه واکنش زنجیره ای پلیمراز برای تکثیر ژن ‏gyrA

مراحل

دما

(‏درجه سانتی‏گراد) ‏

زمان ‏(‏دقیقه) ‏

تعداد سیکل‏ها

دناتوراسیون اولیه

95

5

-

دناتوراسیون هر چرخه

96

5/0

40

اتصال پرایمرها

68

1

طویل شدن

72

5/0

طویل شدن نهایی

72

10

-

 

 

جدول 2- ویژگی‏های پرایمرهای طراحی شده

ΔG (‏ΔH-TΔS) تشکیل ساختارهای ثانویه

ΔS

طول

GC%

Tm

‏(‏درجه سانتی‏گراد) ‏

ΔH

ترادف

(‏5'-3') ‏

نام

-76/2 تا -84/1

-77/101 تا -07/86

20

75

66

-33/1 تا -26/5

CGATTCCGGCTTCCGCCCGG

F

-2/0 تا + 78/0

-66/58 تا -24/51

21

4/71

9/65

-7/17 تا – 5/14

CGCCAGGCAATGACCCACCGG

R

-84/2 تا -31/2

-08/134 تا -82/138

23

9/69

2/66

-7/42 تا -8/43

GCACGGCGACGCGTCGATCTACG

94 M1

-63/3 تا -94/1

-44/38 تا -38/128

24

7/66

8/66

-9/44 تا -2/40

GCACGGCGACGCGTCGATCTACGA

94 M2

-31/2 تا -09/2

-46/82 تا -64/67

25

72

9/69

-9/26 تا -2/22

GCAACTACCACCCGCACGGCGACGC

90

-31/2 تا -93/1

-46/82 تا -16/98

27

4/70

7/71

-9/26 تا-2/31

GCAACTACCACCCGCACGGCGACGCGT

91

 


روش‏های مولکولی برای تعیین موتاسیون

در این تحقیق، ‏دو روش مولکولی ‏AS-PCR‏ و تعیین ترادف به شرح زیر برای تعیین موتاسیون در منطقه ‏QRDR بررسی مقایسه ای شدند. ‏

روش AS-PCR

روشی برای تشخیص SNP ‏است. ‏در این تکنیک طراحی دقیق پرایمر‏های داخلی مهم است، به گونه ای که موتاسیون‏‏های احتمالی در ناحیه 3′ آن‏ها شناسایی شود. ‏‏پرایمر‏های اختصاصی برای تکنیک AS-PCR برای کدن‏‏های 90، ‏91 و دو آلل کدن 94 ‏(‏تحت عنوان پرایمر‏های داخلی) طراحی و ساخته شدند ‏(‏جدول 4) پرایمر‏های انتخاب شده به ‏شرح 1 و ترکیب پرایمرها و
 شرایط واکنش به شرح جدول 3 هستند. ‏در هر دو نوع سویه‏های حساس و مقاوم به افلوکساسین، طراحی و اجرای روش Allell specific (‏ARMS)‏ برای تعیین موتاسیون در ژن gyrA در سویه‏های مقاوم به داروی افلوکساسین مایکوباکتریوم توبرکلوزیس به کار گرفته شد. ‏این روش بر مبنای اتصال یا عدم اتصال پرایمر اختصاصی از انتهای 3′ به نوکلئوتید هدف است. ‏

روش AS-PCR مورد استفاده برای شناسایی موتاسیون‏های موجود در ژن gyrA، ‏به منظور تشخیص سویه‏های حساس از سویه‏های مقاوم به افلوکساسین، ‏طبق پروتکل زیر (‏جدول 3) و در حجم نهایی 25 میکرولیتر انجام شد.

 

 

شکل 1 - محل قرار‏گیری پرایمرهای طراحی شده برای MultiplexAllele specific-PCRبا کمک برنامه MEGA

 

 

جدول3- مقدار ترکیبات استفاده شده در مخلوط واکنشAllele Specific-PCR

بررسی موتاسیون در کدن

- m294

بررسی موتاسیون در کدن -m194

بررسی موتاسیون در کدن 91

بررسی موتاسیون در کدن 90

3/2

DNA

3/2

DNA

3/2

DNA

5/2

DNA

2/5

BUFFER

2/5

BUFFER

2/5

BUFFER

5/2

BUFFER

2/8

F

2/8

GF

2/8

GF

8/2

GF

2/5

R

2/5

GR

2/5

GR

2/5

GR

4/1

M2

3/4

M1

4

91

3/5

90

1

dNTP

1

dNTP

1

dNTP

1

dNTP

8/0

DNA taq polymerase

8/0

DNA Taq polymerase

8/0

DNA Taq polymerase

8/0

DNA Taq polymerase

 

 

میکروتیوب‏ها در دستگاه ترمال سایکلر قرار داده و طبق برنامه داده شده به دستگاه ‏PCR انجام شد‏. ‏سپس، الکتروفورز روی ژل آگاروز 8/1درصد انجام و ژل، برای بررسی نتایج با دستگاه ترانس لومیناتور با اشعه U. ‏V مشاهده شد‏. ‏در پایان انطباق فنوتیپی و ژنوتیپی انجام شد. ‏

انجام تعیین ترادف[2]

برای ارزیابی روش تعیین موتاسیون با کمک
AS-PCR، ‏از روش تعیین توالی، ‏به‏عنوان استاندارد طلایی مولکولار استفاده شد. ‏در این روش، ‏قطعه مورد نظر که محتوی کدون‏های موتان بود با انجام PCR با پرایمر‏های اختصاصی تکثیر شد. ‏محصول PCR پس از تخلیص برای انجام تعیین توالی با دستگاه
 Applied Biosystem به شرکت SourceBioScience انگلستان فرستاده شد. ‏

 

نتایج

نتایج PCR

انجام ‏PCR ساده ژن gyrA روی تمامی 41 نمونه مطالعه شده، ‏باند bp 194را ارائه کرد که نشان دهنده انتخاب صحیح پرایمرها و تعیین برنامه مناسب تکثیر بود. ‏محصول PCR ‏در شکل ‏‏1 برای 4 نمونه نشان داده شده است. ‏

 

شکل2- باند 194bp حاصل از تکثیر ژن gyrA با استفاده از پرایمرهای f و r در 4 نمونه 12x, 668, 2n, 1511

 

نتایج AS-PCR

پرایمرهای اختصاصی برای تکنیک
 AS-PCR برای کدن‏های 90، ‏91 و دو آلل کدن 94 ‏(‏تحت عنوان پرایمرهای داخلی) به خوبی قادر به تشکیل باند در محل اختصاصی خود شد‏ند. ‏این مسئله نشانگر صحت طراحی پرایمر، ‏دمای آنیلینگ و برنامه PCR بود. ‏

پرایمرهای طراحی شده در این تحقیق برای حالت وحشی ‏(‏بدون موتاسیون)، ‏باند‏های مناسبی در حالت
 AS-PCR ارائه کرد که نشانگر دقیق بودن طراحی و انتخاب برنامه مناسب PCR ‏در این حالت است. ‏با توجه به این‏که پرایمر از 3′ به رشته الگو متصل می‏شود، اگر ‏ژن در آن ناحیه جهش داشته باشد پرایمر آن را شناسایی نکرده و اتصال انجام نمی‏شود ‏(‏عدم تشکیل باند در الکتروفورز). ‏تشکیل باند مشخص کننده سویه حساس ‏(‏شکل 3) و عدم تشکیل آن اثبات کننده رخداد موتاسیون است ‏(‏شکل 3 ستون‏های E 1511 D,111). ‏در مجموع، ‏از 41 سویه کلونیکی مایکوباکتریوم توبرکلوزیس مطالعه شده، ‏37 سویه از نظر فنوتیپی مقاوم به افلوکساسین و 4 سویه حساس به این دارو بودند. ‏از 37 سویه مقاوم از نظر فنوتیپی، 32 سویه با روش AS-PCR مقاوم به افلوکساسین و 5 نمونه حساس تعیین شدند. ‏

 

شکل3- ‏تصویر الکتروفورز دو نمونه حساس 73 ‏و e 35: باندهای اصلی و داخلی تکثیر شده که نشانگر عدم موتاسیون ‏و حساسیت نمونه‏ها به افلوکساسین است. ‏

 

 

جدول 4- الگوهای متفاوت ایجاد شده در روی ژل توسط پرایمرهای طراحی شده در این مطالعه

الگوی A ‏‏

الگویB ‏

الگویC

الگویی D ‏

الگویE

پرایمرهایF,R ‏

‏پرایمرهای F,R,90 ‏‏

پرایمرهای F,R,91 ‏‏

پرایمرهای F,R,94 (‏M1) ‏

پرایمرهای F,R,94 (‏M2) ‏

194bp

باند اصلی

194bp به تنهایی نشانه

رخداد جهش (‏مقاوم)

194bp به تنهایی نشانه

رخداد جهش (‏مقاوم)‏

194bp به تنهایی نشانه

رخداد جهش (‏مقاوم)

194bp به تنهایی نشانه

رخداد جهش (‏مقاوم)‏

88bp به همراه ‏194bp

عدم جهش (‏حساس)‏

90bp به همراه ‏194bp

عدم جهش (‏حساس)‏

100bp به همراه ‏194bp

عدم جهش (‏حساس)

101bp به همراه ‏194bp

عدم جهش (‏حساس)

 

 

در شکل 4 محصولات PCR زیر الکتروفورز شده‏اند:

ستونA تکثیر نمونه 111 با استفاده از پرایمرهای
‏F ,R است که باند 194 جفت بازی می‏دهد.

ستونB تکثیر نمونه 111 با استفاده از پرایمرهای
F ,R ,90 ‏است که باند اصلی 194 جفت بازی و باند داخلی 88 جفت بازی تشکیل شده است. ‏بنابراین، در کدن 90 موتاسیونی رخ نداده است. ‏

ستون C تکثیر نمونه 111 با استفاده از پرایمرهای
‏F ,R , 91 است که باند اصلی 194جفت بازی و باند داخلی 90 جفت بازی تشکیل شده است. ‏بنابراین، در کدن 91 موتاسیونی رخ نداده است. ‏

ستون D تکثیر نمونه 111 با استفاده از پرایمرهای
‏F ,R ,94-M1 است که باند اصلی 194 جفت بازی تشکیل شده اما باند داخلی 100جفت بازی تشکیل نشده است. ‏بنابراین در نوکلئوتید اول کدن 94 موتاسیون رخ داده است.

ستونE تکثیر نمونه111 با استفاده از پرایمرهای
F ,R ,94-M2 است که باند اصلی 194جفت بازی و باند داخلی 101 جفت بازی تشکیل شده است. ‏بنابراین در نوکلئوتید دوم کدن 94 موتاسیونی رخ نداده است. ‏طبق نتیجه به دست آمده نمونه 111 با موتاسیون در نوکلئوتید اول کدن 94 ژن gyrA دچار مقاومت به افلوکساسین شده است.

علاوه بر این، ‏تحلیل ژنتیکی سویه 1511 نیز در شکل 3 ارائه شده است. ‏

ستون A ‏تکثیر نمونه 1511 با استفاده از پرایمرهای
F, R است که باند 194 جفت بازی می‏دهد. ‏

ستونB تکثیر نمونه 1511 با استفاده از پرایمرهای
F ,R ,90 است که باند اصلی 194 جفت بازی و باند داخلی 88 جفت بازی تشکیل شده است. ‏بنابراین، در کدن 90 موتاسیونی رخ نداده است. ‏

ستون C تکثیر نمونه 1511 با استفاده از پرایمرهای
‏F ,R ,91 است که باند اصلی 194 جفت بازی و باند داخلی 90 جفت بازی تشکیل شده است. ‏بنابراین، در کدن 91 موتاسیونی رخ نداده است.

ستون D تکثیر نمونه 1511 با استفاده از پرایمرهای
F ,R ,94-M1 است که باند اصلی 194 جفت بازی و باند داخلی 100 جفت بازی هر دو تشکیل شده اند. ‏بنابراین، در نوکلئوتید اول کدن 94 موتاسیونی رخ نداده است.

ستونE تکثیر نمونه1511 با استفاده از پرایمرهای
F ,R ,94-M2 است که باند اصلی 194 جفت بازی تشکیل اما باند داخلی 101 جفت بازی تشکیل نشده است. ‏بنابراین، در نوکلئوتید دوم کدن 94 موتاسیون رخ داده است. ‏طبق نتیجه به دست آمده نمونه 1511 با موتاسیون در نوکلئوتید دوم کدن 94 ژن gyrA دچار مقاومت به افلوکساسین شده است. ‏

 

 

‏شکل 4- تصویر الکتروفورز محصولات AS-PCR ‏دو نمونه XDR 1511 و 111

نمونه 290 که در شکل 4 مشاهده می‏شود، در کدن 90 دچار جهش است (‏ستونB شامل: محصول PCR با پرایمرهای f,r,90) زیرا باند داخلی مربوط به این کدن که 88 جفت بازی است تشکیل نشده است و تنها باند
اصلی 194 جفت بازی مربوط به تکثیر با پرایمر‏های f,r تشکیل شده است. در نتیجه، این نمونه به افلوکساسین مقاوم است. ‏در سایر ستون‏ها ‏(‏C, D, E)‏ باند‏های داخلی 90، 100 و 101 جفت بازی دیده می‏شوند که به ترتیب به کدن‏های 91، m1 94 و m294 مربوط هستند. ‏

200 bp

 

‏شکل 5- تصویر الکتروفورز نمونه290 مقاوم به افلوکساسین با موتاسیون در کدن 90 (‏ستون B)‏ ‏

 

 

 

جدول 5- نتایج AS-PCR و تعیین توالی

ردیف

نمونه

فنوتیپی مقاومت به فلوروکینولون‏ها

‏‏90

91

94

وجود موتاسیون در منطقه

QRDR

نتیجه تعیین ترادف

M2

M1

1

568

R

 

 

 

 

Y

Mut:91

2

535

R

 

 

 

 

Y

Mut:90

3

124x

R

 

 

 

mut

Y

MUT90

GCGàGTG

4

665

R

 

 

 

 

Y

Mut:m2

5

2n

R

mut

 

 

 

Y

Mut:90

6

194

R

mut

 

mut

 

Y

MUT:94

GACàAAC

7

12x

S

حساس

N

MUT90

GCGàGTG

8

21N

S

حساس

N

MUT:M1

9

35e

S

حساس

N

 

10

26e

S

 

N

 

 

 


جدول نتایج AS-PCR و تعیین توالی

در جدول 5، همه 41 سویه به همراه نتیجه آزمایش AS-PCR آن‏ها‏ آورده شده است. ‏همان‏طور که در این جدول مشاهده می‏شود با استفاده از روش یاد شده مشخص شده که هر یک از سویه‏ها در کدام کدن خود دچار موتاسون شده و در نتیجه به افلوکساسین مقاومت نشان داده اند. ‏نتایج به دست آمده به شکل تصادفی در مورد برخی نمونه‏ها با نتایج تعیین ترادف مقایسه شده است. تطابق بین نتایج نشان دهنده دقت روش یاد شده است. ‏همانگونه که در جدول مشاهده می‏شود 41 نمونه آزمایش شده اند که از بین آن‏ها‏ به لحظ فنوتیپی 31 نمونه مقاوم و 10 نمونه حساس بودند. ‏با انجام آزمایش‏ AS-PCR بر روی آن‏ها‏ مشخص شد‏ که همه 31 نمونه به لحاظ ژنوتیپی هم مقاوم‏اند. ‏10 نمونه به لحاظ فنوتیپی حساس بودند که به لحاظ ژنوتیپی و از طریق روش AS-PCR ‏هم حساس شناسایی شدند. ‏از 31 نمونه مقاوم 5 سویه به علت رخ دادن موتاسیون در کدن 90 9، سویه به علت رخداد موتاسیون در کدن 91، 9 سویه به علت رخداد موتاسیون در کدون 94-M1، و13 سویه به علت رخداد موتاسیون در کدن 94-M2 خود، ویژگی ‏مقاومت نسبت به افلوکساسین ‏را به دست آورده اند. ‏تعداد 5 سویه نیز از 31 سویه مقاوم، در دو کدن خود دارای موتاسیون و مقاومت به افلوکساسین بودند. ‏روش ‏مولکولی استاندارد تعیین ترادف است. ‏که روی 16 سویه ‏(‏10 نمونه حساس و 6 سویه مقاوم)‏ ‏انجام شد. ‏از این تعداد، 8 سویه حساس و 6 سویه مقاوم تعیین شدند. ‏بدین ترتیب حساسیت روش AS-PCR در مقایسه با روش فنوتیپی 100 و ویژگی روش نیز 100 درصد است. ‏در مقایسه با روش تعیین ترادف حساسیت و ویژگی به ترتیب 75 و 100 درصد است.

بررسی نتایج تعیین ترادف

نتایج تعیین ترادف نشان می‏دهد که کدن 90 دارای توالی GCG است که کد‏کننده اسید آمینه آلانین است. ‏موتاسیون در این کدن سبب جانشینی ‏T به جای C می‏شود و در نتیجه توالی به GTG تغییر می‏یابد که کد کننده اسید آمینه والین است. ‏کدن 91 دارای توالی TCG است که کدکننده اسید آمینه سرین است. ‏موتاسیون در این کدن سبب جانشینیC به جای T می‏شود و در نتیجه توالی به CCG تغییر می‏یابد که کد کننده اسید آمینه پرولین است. ‏همچنین، این نتایج نشان می‏دهد که کدن 94 دارای توالی GAC است که کد کننده اسید آمینه آسپارژین است. اما ‏موتاسیون‏های متعدد در این کدن سبب انواع جانشینی می‏شود‏. ‏از جمله ‏G به جای A قرار گرفته و توالی GGC تشکیل می‏شود که گلایسین را کد می‏کند. ‏حالت دیگر آن است که C به جای A قرار گرفته، ‏توالی GCG تشکیل می‏شود که کد کننده آلانین است. ‏در حالت سوم A جایگزین G ‏می‏شود و توالی AAC تشکیل می‏شود که کد‏کننده آسپارژین است. ‏و در حالت دیگر دو T به جای ‏G و A قرار گرفته و توالی TTC شکل می‏گیرد که اسید آمینه فنیل آلانین را کد می‏کند. ‏

بحث و نتیجهگیری

فلوروکینولون‏ها، ترکیبات تازه تولید شده ای مثل موکزی فلوکساسین، گاتی فلوکساسین، افلوکساسین و آمینوگلیکوزیدهای تزریقی (‏کانامایسین و آمیکاسین) ‏و پپتیدهای حلقوی کاپرئومایسین، همگی فعالیت آنتی‏باکتریال خوبی بر ضد مایکوباکتریوم توبرکلوزیس دارند که البته متاسفانه به علت افزایش رنج جهش یافته‏های منجر به مقاومت به این آنتی‏بیوتیک‏ها، سویه‏های XDR-TB و حتی TDR-TB ایجاد شده اند که درمان بسیار سخت و پر هزینه ای دارند و حتی ممکن است بیمار درمان نشود و ضمن رها بودن در جامعه، می‏تواند افراد بی‏شماری را بیمار کند که بیماری آن‏ها‏ نیز از همان ابتدا به شکل XDR یا
 (‏Total Drug Resistance) ‏TDR خواهد بود. ‏که این مطلب از نظر همه‌گیر شدن بیماری بسیار حائز اهمیت است (‏3). ‏

هدف سلولی فلوروکینولون‏ها در مایکوباکتریوم توبرکلوزیس، آنزیم DNAgyrase است. ‏این آنزیم شامل دو زیر واحد آلفا و بتا است که زیر واحد آلفا توسط ژن gyrA و زیرواحد بتا توسط ژن gyrB کد می‏شوند. ‏جهش‏ها در ناحیه کوچک gyrAانجام می‏شود که ناحیه معین مقاوم به کینولون‏ها ‏(‏QRDR) نامیده می‏شود. ‏در تعداد کمتری از سویه‏های مایکوباکتریوم توبرکلوزیس، مکانیسم اولیه مقاومت به فلوروکینولون‏ها‏، با رخداد جهش در ژن gyrB دیده شده است (‏11) ‏

تحلیل ناحیه QRDR به تنهایی از طریق آزمایش‏‏های ژنوتایپینگ انجام می‏شود. این آزمایش‏ها به عنوان آزمایش‏های سریع شناسایی، شناخته شده‏اند. ‏در حدود 90 تا 95 درصد سویه‏های مقاوم به یک یا بیش از یک داروی تزریقی شامل موتاسیون‏هایی در نزدیکی
انتهای 3′ ژن rrs ‏( S rRNA16) شامل نواحی نوکلئوتیدی A1401,C1402,G1484 است. ‏تاکنون از روش‏های تعیین ترادف و SSCP برای تعیین رخداد جهش‏ها در ناحیه QRDR از کدون 89 تا 94 استفاده شده است. ‏

 حالت ‏وحشی به عنوان شاخص و هرگونه حالت غیر‏طبیعی به عنوان موتان در نظر گرفته می‏شود. به این ترتیب فارغ از نوع موتاسیون و تبدیل ASP به هر اسید‏آمینه دیگر در کدون 94 پرایمرهایی برای حالت وحشی طراحی شده و که تمام انواع موتاسیون‏های احتمالی شناخته شده یا نشده را پوششش می‏دهد. ‏اطلاعات به دست آمده نشان داده اند که تمرکز موتاسیون‏ها ‏در کدون 90-91 و 94 ‏و البته به شکل پراکنده در کدون‏های 74 و87 است. ‏در این مطالعات روی این سه کدون اصلی 90-91 و 94 تمرکز شد‏. ‏موتاسیون در کدون 90 به شکل Ala-90-Val و
 Ser-91-Pro انجام می‏شود. ‏اما در 94در هر دو جایگاه 1و 2 به شکل کاملا متنوع رخ می‏دهد (‏11 و 12). ‏

در مطالعاتی که در کشور کویت انجام شده مشخص شده که اگرچه فلوروکینولون‏‏ها، برای شیمی درمانی سل و آزمایش‏های حساسیت دارویی برای داروهای خط دوم استفاده نمی‏شوند اما در 7درصد از سویه‏های MDR-TB موتاسیون در ژن gyrAوجود دارد. ‏و بنابراین، آزمایش‏های حساسیت دارویی عادی برای این داروی مهم خط دوم نیاز هستند. (‏13). ‏

اهمیت تعیین موتاسیون‏های منطقه QRDRژن gyrA بدین دلیل است که موتاسیون در هر یک از کدون‏های 91، 90 و 94 باعث مقاومت به هر یک از فلوروکینولون‏ها می‏شود (‏11 و 12). ‏علاوه بر آن، ‏بر‏اساس تعریف WHO و CDC اثبات موتاسیون در فلوروکینولون‏ها به همراه موتاسیون در ژن rrs، در یک سویهMDR، بیانگر سویه XDR است (‏14). ‏این مطالعه روی 3 کدون اصلی 90- 91 و94 تمرکز شد‏. ‏موتاسیون در کدون 90 به شکل Ala-90-Val و Ser-91-Pro انجام می‏شود. ‏اما در 94 در هر دو جایگاه 1و 2 به شکل کاملا متنوع رخ می‏دهد. ‏

علت انتخاب کدون‏های 90-91 و 94 بر اساس بررسی متون و رخداد موتاسیون در این کدون‏ها در سویه‏های مقاوم بوده است. ‏بدین معنی که سویه‏های مقاوم به فلوروکینولون‏ها، بیشتر در کدون 94 با فراوانی بسیار زیاد (‏بیش از 70 درصد) در کدون 91 با فراوانی 10 تا 15درصد و در کدون 90 با فراوانی 5 درصد دچار جهش شده اند. ‏موتاسیون در سایر کدون‏ها در ناحیه QRDR با فراوانی کمتر از 2 درصد رخ می‏دهد (‏11) ‏

علت مولکولی انتخاب این کدون‏ها این است که کدون 94، اسید آمینه ای را کد می‏کند که در محل پیچش DNA به دور پروتئین، قرار می‏گیرد. ‏بنابراین، هر گونه تغییر در این اسید آمینه باعث نقص در عملکرد زیرواحد آلفای آنزیم DNAgyrase می‏شود. ‏به همین دلیل موتاسیون در کدون 95، که اسید آمینه کد شده توسط آن، ارتباط ساختاری با DNA ندارد، هیچگونه تاثیری در بروز مقاومت ندارد و بنابراین، این کدون، کدون پلی مورفیسم ‏محسوب می‏شود (‏15). ‏

تشخیص مقاومت به فلوروکینولون‏ها، اهمیت ویژه‏ای در همه گیری بیماری سل در جامعه دارد. ‏استفاده از کیت‏ها، ‏بیشتر نیاز به تامین دستگاه‏های پرهزینه همراه داشته و وابستگی همیشگی آزمایشگاه به کیت را به‏دنبال دارند. ‏ضمن این‏که هزینه اجرای آزمایش‏ را نیز بسیار افزایش می‏دهند. ‏‏این روش‏ها پرهزینه و وقت گیر بوده و امکان استفاده از آن به شکل عادی وجود ندارد. بنابراین، روش‏های ساده‏تر در استفاده عادی ترجیح داده می‏شوند (‏4) ‏

در اجرای عادی، ‏روش‏های موسوم به In-house، ‏که شامل انواع روش‏های PCR هستند، ‏مناسب‏تر به نظر می‏رسند (‏16) در جدول7، از تعیین توالی به عنوان استاندارد طلایی مولکولی استفاده به شده است. ‏نتایج به دست آمده، انطباق قابل قبولی به لحاظ حساسیت و ویژگی، بین نتایج یاد شده را نشان می‏دهد که اثبات کننده کارایی روش در استفاده عادی است. ‏روش اصلی برای بررسی موتاسیون در ژن‏های مرتبط با مقاومت، ‏تعیین موتاسیون‏های احتمالی با کمک تعیین توالی است (‏5 و 9 و 10 و17). ‏این روش هزینه بر و پر زحمت بوده و با توجه به عدم امکان خرید دستگاه و تامین کارکنان متخصص در تمام مراکز، ‏لازم است به مراکز خاص ارسال شود که زمان بیشتری می‏برد. ‏از این روش نمی‏توان در اجرای عادی استفاده نمود (‏4). ‏SSCP، روش دیگری است که در چند تحقیق برای بررسی رخداد موتاسیون به ویژه در کدون 94 استفاده شده است (‏18). ‏این روش به خطای آزمایشگر بسیار حساس بوده و بنابراین، هر گونه بی دقتی آزمایشگر به تشخیص اشتباه مقاومت منجر می‏شود. ‏به ویژه در تشابه الگوی به دست آمده از موتاسیون در کدون 94 (‏وابسته به مقاومت)‏ و 95 (‏غیر مرتبط با مقاومت) ‏می‏شود‏. ‏

با توجه به نتایج این تحقیق، ‏روش As-PCR ارائه شده می‏تواند به عنوان یک روش ساده و سریع برای تعیین مقاومت به افلوکساسین در سویه‏های مایکوباکتریوم توبرکلوزیس استفاده شود. ‏

کوشش‏‏ها در برای دستیابی به روش RFLP و یافتن آنزیم‏های اندونوکلئازی که قادر به برش منطقه 94 باشد، به جایی نرسیده است. ‏بنابراین، در این تحقیق از روش آلل اسپسیفیک پی سی آر (AS-PCR)[3] استفاده شد. ‏به این منظور پرایمرهای اختصاصی طراحی شد‏ند. این پرایمرها برای شناسایی حالت وحشی در جایگاه شماره 2 در 90، 1 در 91، 1 و 2 در 94 تحت عنوان
 m1 و m2. ‏این ‏طراحی با توجه به بررسی متون انجام شد و تعیین این مطلب که موتاسیون در کدون 94، در هر دو جایگاه1 و2 به کرات شناسایی شده است، انجام شد. ‏

از میان 41 سویه ای که نتیجه آزمایش‏ AS-PCR آن‏ها‏ موتاسیون و مقاومت را نشان داد: 5 ‏سویه به علت رخ دادن موتاسیون ‏در کدن 90، 8 سویه به علت رخداد موتاسیون در کدن 91، ‏8 سویه به علت رخداد موتاسیون در کدون 94-M1، و 12سویه به علت رخداد موتاسیون در کدن 94-M2 خود، ویژگی ‏مقاومت نسبت به افلوکساسین ‏را به دست آورده اند. ‏

تعداد 5 سویه نیز از 41 سویه آزمایش‏ شده نیز، در دو کدن خود دارای موتاسیون و مقاومت به افلوکساسین بودند. ‏همچنین، از این تعداد سویه آزمایش‏ شده، 5 سویه حساسیت به افلوکساسین را نشان دادند. ‏از 4 سویه حساس فنوتیپی ‏هم به عنوان شاهد ‏در انجام آزمایش‏‏ها استفاده شد‏. ‏

 

 

جدول 6- پیشینه بررسی موتاسیون در ژن gyrA به روش‏های متفاوت درسال‏ها و کشورهای مختلف

کشور

بازه زمانی

هدف

موتاسیون

تعداد نمونه‏های آزمایش‏ شده

تعداد نمونه‏های مقاوم فنوتیپی

درصد موتاسیون یافته‏ها

روش مولکولی انجام شده

کل

مقاوم

حساس

مقاوم

حساس

مقاوم

حساس

هند

N. ‏S. ‏

gyrA

D94N ‏(‏GAC/AAC) ‏

118

72

46

1

0

‏40

0

Sequencing. ‏QRDR of gyrA and gyrB

هنگ کنگ

1994-2004

gyrA

D94N ‏(‏GAC/AAC) ‏

250

71

179

1

0

40

0

PCR-SSCP and Sequencing. ‏QRDR of gyrA

کره جنوبی

2004

gyrA

D94N ‏(‏GAC/AAC) ‏

73

63

10

2

0

20

0

Sequencing. ‏QRDR of gyrA and gyrB

هنگ کنگ

1991-2000

gyrA

D94N ‏(‏GAC/AAC) ‏

138

55

83

1

0

80

0

PCR-SSCP and sequencing. ‏gyrA: 320bp fragment

چین

N. ‏S. ‏

gyrA

D94N ‏(‏GAC/AAC) ‏

68

44

24

0

0

0

0

PCR-SSCP and Sequencing. ‏QRDR of gyrA

روسیه

2006

gyrA

D94N ‏(‏GAC/AAC) ‏

70

48

22

10

0

20

0

Sequencing. ‏QRDR of gyrA and gyrB

روسیه

N. ‏S. ‏

gyrA

D94N ‏(‏GAC/AAC) ‏

185

67

118

8

0

90

0

Oligobased chip assay and sequencing. ‏QRDR of gyrA

 

 

 

همانگونه که در جدول 6 مشاهده می‏شود، روش‏های مولکولی مورد استفاده تاکنون، برای تشخیص موتاسیون در منطقه QRDR، بیشتر مبتنی بر روش تعیین توالی است. ‏این روش، کارایی مناسبی دارد اما با توجه به هزینه و زمان بر بودن اجرای این روش در آزمایشگاه‏های عادی، امکان استفاده از آن وجود ندارد. ‏چنگ[iv] در سال 2004 و هوارد[v] در سال 1994، از روش sscp استفاده کرده اند. ‏این روش که بر مبنای ژن خالص شده و بررسی مقایسه ای الگوی باندهای به دست آمده، در سویه‏های حساس و مقاوم است، بیشتر با احتمال بالای خطای کارکنان همراه است، که در استفاده عادی و حجم بالا، پاسخ‏های منفی و مثبت کاذب را افزایش می‏دهد. ‏بر اساس جدول ذکر شده در بیشتر مطالعات، کدن 89 به عنوان کدن مرتبط با مقاومت مطرح نشده است. ‏بنابراین، در مطالعه حاضر، با هدف ساده‏سازی روش، این کدن مطالعه نشده است. ‏ضمن آن‏که بررسی نتایج تعیین توالی نمونه‏ها، هیچگونه موتاسیونی را در این کدن نشان ندادند. ‏

در داخل کشور مطالعه ای روی این ژن در سویه‏های کلونیکی مایکوباکتریوم توبرکلوزیس با کمک روش AS-PCR یافت نشد. ‏در خارج کشور نیز مطالعات انجام شده با کمک روش پرهزینه و وقت گیر تعیین ترادف بوده و در هیچ مطالعه ای استفاده از روش AS-PCR مشاهده نشد. ‏

همان‏طور که ذکر شد‏ مطالعات انجام شده در کشورهای مختلف به این شکل بوده که به منظور انجام تعیین ترادف یکPCR ‏با حجم نهایی 50 یا 100 میکرولیتری انجام می‏شده و سپس نمونه‏ها تعیین ترادف می‏شدند که این روشی وقت‏گیر و برای بیماران پر هزینه است و نیاز به کارکنانی با مهارت و امکانات آزمایشگاهی در آزمایشگاه‏های عادی دارد. ‏از جمله این مطالعات می‏توان به موارد زیر اشاره کرد:

روش AS-PCR برای تعیین موتاسیون در ژن gyrA در سویه‏های مقاوم به داروی افلوکساسین مایکوباکتریوم توبرکلوزیس ‏روشی سریع و در دسترس و همچنین با قدرت تشخیصی و دقت بالا است. ‏نتایج این تحقیق نشان می‏دهد که ‏AS-PCR می‏تواند به عنوان یک روش سریع و عادی در تشخیص مقاومت مایکوباکتریوم توبرکلوزیس به افلوکساسین در آزمایشگاه‏های تشخیص طبی استفاده شود. ‏این روش برای تشخیص سریع و در دسترس سویه‏های مقاوم باکتری و درمان به موقع بیماران مبتلا و جلوگیری از افزایش هزینه بیماران انجام شد. استفاده از این روش می‏تواند به حذف سریع‏تر یک عامل انتشار بیماری به دنبال تشخیص به موقع یک بیمار مقاوم به دارو و درمان آن منجر شود که این مساله ازدیدگاه همه‏گیر شدن بیماری بسیار دارای اهمیت است. ‏از آنجایی که روش ارائه شده در این تحقیق، هیچگونه وابستگی به کیت، دستگاه ویژه و یا مواد ویژه و اختصاصی برای آزمایشگاه عادی به دنبال ندارد و نیز هزینه برای روش، در حد یک PCR کاملا معمولی بوده و هیچگونه هزینه اضافی به آزمایشگاه تحمیل نمی‏کند همچنین، ‏سرعت عمل روش قابل قبول است. بنابراین، امکان اجرای آن، به عنوان آزمایش‏ عادی آزمایشگاهی، حتی در آزمایشگاه‏هایی که تعداد نمونه‏های مورد پذیرش بالایی به شکل روزانه دارند، وجود دارد و پیشنهاد می‏شود که این روش جایگزین روش‏های سخت و پر هزینه در آزمایشگاه‏های عادی و مراکز تحقیقاتی شود. ‏

تشکر و قدردانی

این پژوهش بخشی از طرح تحقیقاتی مصوب دانشگاه علوم پزشکی اراک و همچنین، قسمتی از پایان‏نامه دانشجویی خانم وحیده وحیدی دانشجوی دوره کارشناسی ارشد است. بنابراین، بدین‏وسیله از معاونت پژوهشی این دانشگاه تشکر و قدردانی می‏شود. ‏

 

 

 

 

 



[1] Wild type

[2] Sequencing

[3] Allelespecific-PCR (AS-PCR)

[iv] Cheng

[v] Howard 

References

(1)  Mardani,m. multi-drug resistant TB: a global problem. Researchin Medicine, Shahid Beheshti University of Medical Sciences. 2008; 31 (4): 299- 301.

(2) Pakzad I, Azizi Jalilian F. Drug resistance mechanism towards Isoniazide in Mycobacterium Tuberculosis considering molecular genetics. Scientific Journal of Ilam University of Medical Sciences 2001; 9 (31): 41-6.

(3) Lawn, SD, Zumla, AI. Tuberculosis. Lancet ‏2011; 378: (9785): 57–72.

(4) H. E. Takiff, “Tuberculosis 2007,” in From Basic Science to Patient Care. Tuberculosis Textbook. Com, J. C. Palomino, S. C. Leão, and V. Ritacco, Eds. pp. 207- 262, 1st edition,.

(5) Pitaksajjakul P, Worakhunpiset S, Chaiprasert A, Boonyasopun J, Ramasoota P. gyrA and gyrB mutations in ofloxacin-resistant Mycobacterium tuberculosis clinical isolates in Thailand. Southeast Asian J Trop Med Public Health. 2011; 42 (5):1163-7.

(6) Chakravorty S, Aladegbami B, Thoms K, Lee JS, Lee EG, Rajan V, Cho EJ, et al. Rapid detection of fluoroquinolone-resistant and heteroresistant Mycobacterium tuberculosis by use of sloppy molecular beacons and dual melting-temperature codes in a real- time PCR assay. J Clin Microbiol. 2011; 49 (3): 932-40.

(7) Von Groll A, Martin A, Jureen P, Hoffner S, Vandamme P, Portaels F, et al. Fluoroquinolone resistance in Mycobacterium tuberculosis and mutations in gyrA and gyrB. Antimicrob Agents Chemother. 2009; 53 (10): 4498-500.

(8) M. Rathore1, Girish Pai1, T. K. Jayalakshmi 2 and D. S. Joshi1 rapid detection of multidrug-resistant mycobacterium tuberculosis by real-time PCR based assay in indian population, 1mgm institute of health sciences, kamothe sec-18, navi mumbai 2jayalakshmi clinic, govandi, mumbai. recent research in science and technology. 2011, 3 (3): 58-62.

(9) Shi R, Zhang J, Li C, Kazumi Y, Sugawara I. Emergence of ofloxacin resistance in Mycobacterium tuberculosis clinical isolates from China as determined by gyrA mutation analysis using denaturing high-pressure liquid chromatography and DNA sequencing. J Clin Microbiol. 2006; 44 (12): 4566-8.

(10)            Perdigão J, Macedo R, João I, Fernandes E, Brum L, Portugal I. Multidrug- resistant tuberculosis in Lisbon, Portugal: a molecular epidemiological perspective. Microb Drug Resist. 2008; 14 (2): 133-43.

(11)            Cui Z, Wang J, Lu J, Huang X, Hu Z. Association of mutation patterns in gyrA/B genes and ofloxacin resistance levels in Mycobacterium tuberculosis isolates from East China in 2009. BMC Infect Dis. 2011 29; 11: 78.

(12)            Aubry A, Veziris N, Cambau E, Truffot- Pernot C, Jarlier V, Fisher LM. Novel gyrase mutations in quinolone-resistant and - hypersusceptible clinical isolates of Mycobacterium tuberculosis: functional analysis of mutant enzymes.Antimicrob Agents Chemother. 2006; 50 (1): 104-12.

(13)            Al- Mutairi NM, Ahmad S, Mokaddas E. First report of molecular detection of fluoroquinolone resistance- associated gyrA mutations in multidrug-resistant clinical Mycobacterium tuberculosis isolates in Kuwait. BMC Res Notes. 2011;14(4): 123.

(14)            World Health Organization, Laboratory Services in Tuberculosis Control: Culture, chapter3, Geneva, 1998 (WHO/TB/98).

(15)            Lari N, Rindi L, Sola C, Bonanni D, Rastogi N, Tortoli E, Garzelli C. Genetic diversity, determined on the basis of katG463 and gyrA95 polymorphisms, Spoligotyping, and IS6110 typing, of Mycobacterium tuberculosis complex isolates from Italy. J Clin Microbiol. 2005; 43 (4): 1617- 24.

(16)            Soini H, Musser JM. Molecular diagnosis of mycobacteria. Clin Chem. 2001; 47 (5): 809- 14.

(17)            Mitarati. S, M Kafwabulula. L. Tropical medicine and health Mycobacterium tuberculosis and gyrA variation in Zambia. Trop Med Health. 2005; 33 (2): 91-4.

(18)            Takiff HE, Salazar L, Guerrero C, Philipp W, Huang WM, Kreiswirth B, et al. Mycobacterium tuberculosis gyrA and gyrB genes and detection of quinolone resistance mutations. Antimicrob Agents Chemother ‏1994; 38 (4): 773-80.