بررسی اینتگرون کلاس 1 و مقاومت آنتی بیوتیکی در سویه‏ها‏ی سالمونلا‏تیفی‏موریوم جداشده از دام و طیور

نویسندگان

1 کارشناس ارشد میکروبیولوژی، دانشگاه آزاد اسلامی، واحد تهران شمال، ایران

2 استادیار میکروبیولوژی، دانشگاه آزاد اسلامی، واحد تهران شمال، ایران

چکیده

  مقدمه : گسترش جدایه‏ها‏ی سالمونلا انتریکا با مقاومت چند‏گانه و مقاومت به آنتی‏بیوتیک در سروتیپ‏ها‏ی سالمونلا یک مشکل حاد جهانی است. اینتگرون‏ها‏ واحدهای ژنتیکی هستند که در انتشار کاست‏های ژنی متحرک در میان میکروارگانیسم‏ها‏ی گرم منفی شرکت دارند. تحرک اینتگرون‏ها‏ با پلاسمیدها و ترانسپوزون‏ها تسهیل می‏شود .   مواد و روش ‏‏ ها: در این پژوهش، فنوتیپ مقاومت به آنتی بیوتیک در 32 سالمونلا تیفی موریوم جدا شده با خواستگاه حیوانی از سال 1390 تا 1391 مطالعه شد. همه نمونه‏ها‏ با استفاده از روش کشت و آزمون استاندارد بیوشیمیایی برای شناسایی سویه‏ها‏ی سالمونلا ارزیابی شدند. پس از استخراج DNA حضور کلاس 1 اینتگرون توسط تکنیک PCR بررسی شد .   نتایج: رایج‏تر‏ین فنوتیپ مقاومت نسبت به سفالوتین (100 درصد)، کلرامفنیکل (7/68 درصد)، آمپی سیلین (5/62 درصد)، تتراسایکلین (2/56 درصد)، آموکسی سیلین/ کلاولانیک اسید (50 درصد)، سولفامتوکسازول (7/43 درصد) مشاهده شد. کلاس 1 اینتگرون به ترتیب در 5/55 درصد و 2/64 درصد از جدایه‏ها‏ی سالمونلا جدا شده از دام و طیور یافت شد .   بحث و نتیجه ‏ گیری: جدایه‏ها‏ی اینتگرون مثبت در مقایسه با جدایه‏ها‏ی اینتگرون منفی، مقاومت بالاتری نسبت به تتراسایکلین، کلرامفنیکل، سولفامتوکسازول، آمپی سیلین و آموکسی سیلین/ کلاولانیک اسید داشتند. اینتگرون‏ها‏ی حامل ژن‏ها‏ی مقاومت به عوامل ضد میکروبی به عنوان مخازن اصلی برای انتشار مقاومت به آنتی بیوتیک مطرح می ‏ شوند .  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Study of class 1 integrons and antibiotic resistance in Salmonella Typhimurium strains isolated from livestock and poultry

نویسندگان [English]

  • Parisa Mobaseri 1
  • Mitra Salehi 2
  • Farzaneh Hosseini 2
1 M.Sc. of Microbiology, Tehran north branch, Islamic Azad University, Tehran, Iran
2 Associate Professor of Microbiology, Tehran north branch, Islamic Azad University, Tehran, Iran
چکیده [English]

  Introduction: Evolution and dissemination of multidrug-resistant Salmonella enterica isolates have been reported. Resistance to antibiotic within Salmonella serotypes is a serious global concern. Integrons are genetic units that participate in capturing and dissemination of mobile gene cassettes among Gram-negative microorganisms. Integron mobility is facilitated by transposons and plasmids.   Materials and methods: Antibiotic resistance phenotype of 32 Salmonella enterica isolates of animal origin which were collected during 2011–2012 were investigated. All samples were assessed by culture method and standard biochemical tests for identification of Salmonella strains. After DNA extraction, the presence of class I integron was examined by PCR .   Results: The most common resistant phenotypes were to cefalothin (100%), chloramphenicol (68/7%), ampicillin (62/5%), tetracycline (56/2%), amoxicillin/ clavulanate (50%), sulfamethoxazole (43/7%). Class 1 integrons were found in (55/5%) and (64.2 %) of Salmonella isolates from livestock and poultry respectively . Discussion and conclusion: Integron positive isolates had higher resistance to tetracycline, chloramphenicol, ampicillin sulfamethoxazole and amoxicillin / clavulanate compared with integron negative isolates. The ability of integrons to integrate resistance gene to antimicrobial agents makes them the main sources in the diffusion of antibiotic resistance .

کلیدواژه‌ها [English]

  • Salmonella typhimurium
  • Class 1 integrons
  • Multidrug resistance

مقدمه

مقاومت آنتی میکروبی به یک مشکل بهداشت عمومی در سراسر جهان تبدیل شده است که این امر، تاثیر مستقیمی بر ایمنی مواد غذایی دارد. بنابراین، نظارت بر پاتوژن‏ها‏ی منتقل شده از مواد غذایی دارای مخازن حیوانی، دارای اهمیت زیادی است (1). تقریبا در تمام کشورهای صنعتی جهان، سالمونلوز یکی از شایع‏ترین بیماری‏ها‏ی منتقل شونده از طریق غذا است. استفاده گسترده از عوامل ضد میکروبی در تولید مواد غذایی حیوانی، می‏تواند زمینه افزایش مقاومت باکتری‏ها‏ نسبت به آنتی بیوتیک‏ها و انتقال آن از طریق محصولات غذایی به انسان را فراهم کند (2). افزایش میزان عفونت با سالمونلای مقاوم در برابر داروهای ضد میکروبی نیازمند توجه ویژه ای است. مطالعات زیادی گویای ظهور سالمونلا انتریکا سروتیپ تیفی موریوم مقاوم به چند دارو (MDR) (2)، سالمونلا تولید کننده بتالاکتاماز طیف گسترده (ESBL) (3 و 4) و سویه‏ها‏ی سالمونلا مقاوم در برابر فلوروکینولون است (2 و 5).در پژوهش‏ها‏ی متعددی از نقش عناصر ژنتیکی مرتبط با حدت و مقاومت‏ها‏ی آنتی بیوتیکی در مورد عفونت‏ها‏ی تهاجمی سالمونلا، گزارش شده است (4). بسیاری از ژن‏ها‏ی مسئول مقاومت در باکتری‏ها‏ی گرم منفی، بخشی از یک کاست ژن در اینتگرون هستند (6 و 7).  اینتگرون حاوی یک ژن از خانواده λ اینتگراز است که نوترکیبی بین دو سایت هدف متمایز را انجام می دهد (8 و 9). اینتگرون‏ها‏ بر اساس مقایسه توالی اسید آمینه اینتگراز خود، کد‏گذاری شده و توسط ژن intIطبقه‏بندی می شوند. بر اساس مطالعات انجام شده در سال‏ها‏ی اخیر بیش از چهار نوع کلاس‏ اینتگرون شناسایی شده است (10 و 11). بیشتر اینتگرون‏ها‏ی سویه‏ها‏ی بالینی خانواده انتروباکترسه‏ها‏، از کلاس 1 هستند (12). رایج‏ترین کاست ‏اینتگرون حاوی ژن‏ها‏ی مرتبط با مقاومت در برابر طیف وسیعی از عوامل ضد میکروبی، از جمله آنتی بیوتیک‏ها‏، آنتی سپتیک‏ها‏ و دزانفاکتانت‏ها‏ست(6 و 7). اینتگرون‏ها‏ از طریق ترانسپوزون‏ها و پلاسمیدها انتشار ژن‏ها‏ی مقاومت در میان باکتری‏ها را امکان پذیر می‏کنند. به نظر می رسد که حضور اینتگرون در سویه‏ها‏، موجب افزایش مقاومت آن‏ها نسبت به انواع آنتی بیوتیک‏ها‏ی رایج می‏شود.

بنابراین، کسب اینتگرون، یکی از عوامل مهم چند مقاومتی در میکروارگانیسم‏ها‏ی‏ گرم منفی، به ویژه در باکتری‏ها‏ی روده ای در نظر گرفته شده است (7 و 13). کلاس 1 و 2 اینتگرون در سروتیپ‏ها‏ی مختلف سالمونلا شناسایی شده‏اند (14). در مطالعه حاضر، پروفایل‏ها‏ی مقاومت ضد میکروبی سالمونلا جدا شده در طول سال‏های 1390 تا 1391 از نمونه‏ها‏ی حیوانی مطالعه شد. علاوه بر این، توزیع کلاس 1 اینتگرون در میان جمعیت مقاوم در برابر دارو نیز بررسی شد.

 

مواد و روش‏ها‏

نمونه گیری، کشت و آزمایش‏های بیوشیمیایی

در مجموع 32 سویه سالمونلا از تابستان 1390 تا تابستان 1391 به ترتیب شامل14 جدایه گاوی و 18جدایه مرغی از نمونه‏ها‏ی حیوانی دام و طیور بخش میکروبیولوژی دانشگاه آزاد اسلامی واحد ساوه جمع‏آوری شدند. نمونه‏ها‏ به محیط کشت انتخابی سالمونلا شیگلا آگار و بیسموت سولفیت آگار (مرک[1]، ساخت آلمان) انتقال یافته و به مدت 24 ساعت در دمای 37 درجه سانتی‏گراد گرمخانه‏گذاری شدند. کلونی‏ها‏ی مشکوک به سالمونلا توسط روش‏های متداول میکروبیولوژی نظیر کشت در محیط‏ها‏ی TSI، لیزین آیرون آگار، سیترات، اوره، رنگ آمیزی گرم و آزمایش‏های متیل رد وگس پروسکئور (مرک) شناسایی شدند. سپس آزمون سروتایپینگ با آنتی سرم‏ها‏ی اختصاصی سروار انجام شد (15). روش دیسک دیفیوژن برای تعیین حساسیت سویه‏ها‏ی سالمونلا بر اساس پروتکل CLSI سال 2011 انجام شد. دیسک‏ها‏ی تهیه شده از شرکت پادتن طب برای تعیین حساسیت سویه‏ها‏ شامل: آمپی سیلین (10 میکروگرم)، تتراسایکلین (30 میکروگرم)، کلرامفنیکل (30 میکروگرم)، سولفامتوکسازول (250 میکروگرم)، نالیدیکسیک اسید (30 میکروگرم)، سفالوتین (30 میکروگرم)، سفتریاکسون (30 میکروگرم)، آمیکاسین (30 میکروگرم)، جنتامایسین (10 میکروگرم)، کانامایسین (10 میکروگرم) و آموکسی سیلین-کلاولانیک اسید (20-10 میکروگرم) بودند. اشریشیاکلی ATCC 25922 به عنوان یک سویه مرجع استفاده شد.

 

واکنش زنجیره ای پلیمراز (PCR)

ژنوم سویه‏ها‏ با استفاده از کیت (متابیون[2]، ساخت آلمان) استخراج شد. حضور کلاس 1 اینتگرون توسط تکنیک PCR (جدول1)، با استفاده از پرایمرهای خاص برای ژن intIدر همه سویه‏ها‏ مطالعه شد (15). مواد PCR از شرکت سیناژن ساخت ایران تهیه و واکنش در حجم ٢٥ میکرولیتر (5/2 میکرولیتر بافر X PCR 10، 5/1 میکرولیتر MgCl2 ٥٠ میلی‏مولار، یک میکرولیتر dNTP١٠ میلی‏مولار، 5/1 واحد آنزیم Taq پلی مراز، یک میکرولیتر با غلظت ١٠ میکرومولار از هر پرایمر، یک میکرولیتر DNA الگو) انجام شد. فرآیند PCR در دستگاه ترموسایکلر (اپندورف[3]، ساخت آلمان) شامل: 5 دقیقه در دمای 95 درجه سانتی‏گراد (واسرشت سازی ابتدایی)، 35 سیکل 30 ثانیه در 95 درجه سانتی‏گراد (واسرشت‏سازی)، 30 ثانیه در 53 درجه سانتی‏گراد (اتصال پرایمر)، یک دقیقه در 72 درجه سانتی‏گراد (گسترش پرایمر) و در نهایت،10 دقیقه در 72 درجه‏ سانتی‏گراد (گسترش نهایی) انجام شد. محصول PCR بر روی ژل آگاروز یک درصد با دستگاه (بیوراد[4]، ساخت آمریکا) الکتروفورز و با نور ماورابنفش مشاهده شد.

 

جدول 1- طول قطعه و توالی پرایمرها intI

توالی پرایمرها́3-́5

ژن

طول قطعه

منبع

F- ACGAGCGCAAGGTTTCGGT

R- GAAAGGTCTGGTCATACATG

IntI

565 bp

16

 

 

 

 

 


نتایج

از میان سویه‏های مورد مطالعه،‏ 9/12 درصد تنها نسبت به یک آنتی‏بیوتیک و 87 درصد دارای مقامت چندگانه (حداقل به 3 گروه آنتی بیوتیک) بودند. در مجموع، 14 نمونه از 18 نمونه جدا شده از دام (7/77 درصد) و 14 از 14 نمونه جدا شده از طیور (100 درصد) دارای مقاومت چندگانه [5]، بودند. در رایج‏ترین فنوتیپ‏ها‏ میانگین مقاومت به سفالوتین (100 درصد)، کلرامفنیکل (7/68 درصد)، آمپی سیلین (5/62 درصد)، تتراسایکلین (2/56/ درصد)، آموکسی سیلین/ کلاولانیک اسید (50 درصد) و سولفامتوکسازول (7/43 درصد) شناسایی شدند. مقاومت به نالیدیکسیک اسید (7/11 درصد)، کانامایسین (8/5 درصد)، سفتریاکسون (صفر درصد)، جنتامایسین (صفر درصد) و آمیکاسین (صفر درصد) مشاهده شد. سویه‏ها‏ی مقاوم در برابر سولفامتوکسازول (5/78 درصد) حامل کلاس 1 اینتگرون بودند. اینتگرون در سویه‏ها‏ی تیفی موریوم دامی 5/55 درصد و طیور 2/64 درصد مشاهده شد (شکل1). جدول 2 مقاومت آنتی بیوتیکی در سویه‏ها‏ی سالمونلا اینتگرون مثبت و منفی را نشان می دهد.

 

 

جدول 2- مقاومت آنتی بیوتیکی در سویه‏ها‏ی سالمونلا اینتگرون مثبت و منفی

 

سفالوتین

سفتریاکسون

آمپی سیلین

جنتامایسین

کانامایسین

آمیکاسین

نالیدیکسیک اسید

سولفامتوکسازول

آموکسی سیلین-کلاولانیک اسید

کلرامفنیکل

تتراسایکلین

طیور +

100

صفر

8/88

صفر

صفر

صفر

2/22

7/77

5/55

100

8/88

دامی +

100

صفر

60

صفر

صفر

صفر

صفر

40

60

60

40

طیور-

100

صفر

80

صفر

صفر

صفر

20

20

20

60

80

دامی-

100

صفر

50

صفر

25

صفر

25

25

50

50

25

 

+ اینتگرون مثبت، - اینتگرون منفی

 

 

 

شکل 1- الکترفورز ژل آگاروز محصول ژن اینتگرون با PCR: ردیف M مارکر ( DNA ladder)، ردیف2 و 3 سویه سالمونلا دارای ژن intI، ردیف 1 کنترل مثبت (باند 565 جفت باز)

بحث و نتیجه گیری

در مطالعه حاضر، میزان گسترده ای از مقاومت نسبت به چندین گروه از آنتی بیوتیک‏ها‏ی رایج مانند کلرامفنیکل، آمپی‏سیلین، تتراسایکلین و سولفونآمیدها در سویه‏ها‏ی سالمونلا مشاهده شد. این یافته‏ها‏ تعجب آور نیست، زیرا این‏گونه آنتی بیوتیک‏ها در سیستم‏ها‏ی مدرن پرورش حیوانات استفاده می شوند (17 و 18). شیوع بالای مقاومت به سولفامتوکسازول (43 درصد) نشان دهنده استفاده زیاد سولفونآمید در حیوانات تولید کننده مواد غذایی است. اینتگرون‏ها‏ نقش قابل توجهی در کسب مقاومت ضد میکروبی باکتری‏ها‏ نسبت به آنتی‏بیوتیک‏ها‏ی مختلف دارند (7 و 13). 5/78 درصد از سویه‏ها‏ی سالمونلای مقاوم در برابر سولفونآمیدها، حضور اینتگرون را نشان دادند. بیش‏ترین مقاومت چندگانه دارویی در خانواده انتروباکتریاسه با حضور اینتگرون گزارش شده است (19،20 و 21). به دلیل حضور بیش از 60 کاست ژنی، وجود اینتگرون‏ها‏ باعث افزایش ویرولانس باکتری زنوتیک می شود، به ویژه هنگامی که حضور کلاس 1 اینتگرون شناسایی شود (19). در این مطالعه، 28 مورد از 32 سویه مقاومت چندگانه را نسبت به آنتی بیوتیک‏ها‏ی رایج نشان دادند. این شرایط می‏تواند راه حل درمانی برای بیماری‏ها‏ی تهاجمی تولید شده توسط سالمونلا را کاهش دهد و احتمال شکست در درمان را به ویژه به دلیل حضور سویه‏ها‏ی مقاوم به فلوروکینولون و بتالاکتام افزایش دهد (22). نتایج مطالعه حاضر با پژوهش‏ها‏ی ماجتانووا و همکاران[vi] در سال 2010 که بیش‏ترین مقاومت جدایه‏ها‏ را نسبت به سولفامتوکسازول، آمپی‏سیلین و تتراسایکلین گزارش می‏کند، و نیز نتایج پژوهش توروو همکاران[vii] در سال 2011 که بالاترین مقاومت جدایه‏ها‏ را نسبت به آمپی‏سیلین، آموکسی سیلین-کلاولانیک اسید، سولفامتوکسازول، تتراسایکلین و کلرامفنیکل گزارش می کند، مطابقت دارد (23 و 24). نتایج الگوی مقاومت جدایه‏ها‏ی این تحقیق با نتایج مقاومت جدایه‏ها‏ی انسانی حاصل از مطالعه رنجبر و همکاران[viii] در سال 2009 که بیش‏ترین مقاومت را نسبت به تتراسایکلین، آمپی سیلین و کلرامفنیکل و نیز نتایج مطالعه رجایی و همکاران[ix] در سال 2011 که بیش‏ترین مقاومت را نسبت به تتراسایکلین، سولفامتوکسازول، گزارش می‏کند مطابقت دارد (25 و 26). داده‏ها‏ی پژوهش حاضر با نتایج پژوهش سلطان دلالو همکاران[x] در سال 2009 که بیش‏ترین مقاومت نمونه‏ها‏ی جدا شده از جوجه و گاو نسبت به نالیدیکسیک اسید، تتراسایکلین را گزارش می‏کند، مطابقت ندارد (27). دلایل این اختلاف می‏تواند به تفاوت در نوع سویه‏ها‏، زمان نمونه‏گیری و میزان شیوع پلاسمید‏ها‏ی حاوی ژن‏های مقاومت آنتی‏بیوتیکی مرتبط باشد. کلاس 1 اینتگرون بیشتر در سویه‏ها‏ی سالمونلا یافت می‏شود. با توجه به این، ون‏اسن زندبرگ و همکاران[xi] حضور 43 درصدی کلاس 1 اینتگرون را در سویه‏ها‏ی جدا شده از حیوانات و انسان‏‏ و گلدستاین و همکاران[xii] 5/61 درصد در سویه‏ها‏ی سالمونلا جدا شده از مرغ را گزارش کردند (28 و 29). در مطالعه گبریس[xiii]، 75 در صد از سویه‏ها‏ی جدا شده از خوک، دارای مقاومت چندگانه و متعلق به کلاس 1 اینتگرون بودند (30). به همین ترتیب، نتایج پژوهش مایکل و همکاران[xiv] نیز حاکی از این بود که در 6/41 درصد از سویه‏ها‏ این عناصر مولکولی مشاهده می شوند (31). همچنین، در مطالعه دیگر توسط پیرانوو همکاران[xv] در برزیل، از 135 سویه سالمونلا 55 مورد حضور کلاس 1 اینتگرون را نشان دادند (32). در مطالعات دیگر در ایران، توسط فیروزه و همکاران[xvi]، 6/41 درصد از سویه‏ها‏ی سالمونلای انسانی حامل کلاس 1 اینتگرون بوند. همچنین، مطالعات ناغونی و همکاران[xvii] شیوع بالای اینتگرون را در بین سویه‏ها‏ی سالمونلا MDR نشان دادند (33 و 34). حضور شایع این عناصر ژنتیکی در میان سویه‏ها‏ی سالمونلا، گویای ارتباط کاهش حساسیت به داروهای انتخابی و استفاده نا مناسب از داروهای ضد میکروبی جایگزین در زمینه‏ها‏ی مختلف و گسترش عوامل مقاومت است. در حال حاضر سفالوسپورین‏ها‏ی طیف گسترده مانند سفوتاکسیم، سفتازیدیم، سفتریاکسون و فلوروکینولون‏ها‏ داروهای انتخابی برای درمان عفونت‏ها‏ی سالمونلاست (33).

نتایج این پژوهش بیانگر این مطلب است که ارتباط تنگاتنگی بین جدایه‏ها‏ی سالمونلا MDR و حضور کلاس 1 اینتگرون وجود دارد. از یک سو سویه‏ها‏ی اینتگرون مثبت، در مقایسه با سویه‏ها‏ی اینتگرون منفی مقاومت بیشتری به تتراسایکلین، کلرامفنیکل، سولفامتوکسازول، آمپی سیلین و آموکسی‏سیلین/ کلاولانیک اسید ، در دام و طیور داشتند. از سوی دیگر، سویه‏ها‏ی دامی اینتگرون منفی نیز مقاومت بالایی نسبت به کانامایسین و نالیدیکسیک اسید داشتند. این یافته‏ها‏ نشانگر آن است که فنوتیپ مقاومت در میان سویه‏ها‏ی سالمونلا، نه تنها به علت حضور کلاس 1 اینتگرون بلکه می‏تواند به حضور دیگر کلاس‏ها‏ی اینتگرون و یا عناصر‏ها‏ی ژنتیکی دیگر مانند ترانسپوزون‏ها مرتبط باشد (33). ارتباط معنی‏داری بین حضور کلاس 1 اینتگرون و مقاومت به سولفونآمید، کلرامفنیکل، آمپی سیلین، تتراسایکلین، استرپتومایسین و تری متوپریم وجود دارد در حالی‏که مقاومت به آنتی‏بیوتیک‏ها‏ی دیگر مستقل از اینتگرون است (35). حیوانات تولید کننده مواد غذایی، ممکن است به طور هم‏زمان به عنوان یک مخزن از اینتگرون و حامل ژن‏ها‏ی مقاومت به آنتی بیوتیک محسوب شوند. در نتیجه امکان دارد که محصولات تولیدی در زنجیره غذایی، به عنوان منابع سویه‏ها‏ی MDR در نظر گرفته شوند. استفاده از آنتی‏بیوتیک‏ها‏ی خاص به مدت طولانی، ممکن است به انتخاب اینتگرون‏ها‏ی حامل عناصر ژنتیکی کمک کند. اگر چه عوامل دیگر مربوط به مقاومت، به طور غیر مستقیم ممکن است به گسترش نیچ آن‏ها منجر شود. نظارت بر تغییرات کاست ژن اینتگرون در جمعیت سالمونلا می‏تواند به جلوگیری از گسترش عوامل تعیین کننده مقاومت در برابر آنتی‏بیوتیک‏ها‏ از طریق زنجیره غذایی از حیوانات به انسان کمک کند.



1. Merck

2. Metabion

3. Eppendorf

4. Biorad

5. Multi Drug Resistance (MDR)

6. Majtaánovaá et al

7. Toro et al

8. Ranjbar et al

9. Rajaei et al

10. Soltan Dallal et al

11. Van Essen-Zandbergen et al

12. Goldstein et al

13. Gebreyes

14. Michael et al

15. Peirano et al

16. Firoozeh et al

17. Naghoni et al

 

References

(1) Caleja C, Toro M, Gonçalves A, Themudo P, Vieira-Pinto M, Monteiro D, et al. Antimicrobial resistance and class I integrons in Salmonella enterica isolates from wild boars and Bísaro pigs. Int Microbiol. 2011; 14 (1): 19-24.

(2) Threlfall EJ. Antimicrobial drug resistance in Salmonella: problems and perspectives in food- and water-borne infections. FEMS Microbiol Rev 2002; 26 (2): 141–8.

(3) Miriagou V, Tassios PT, Legakis NJ. Expanded-spectrum cephalosporin resistance in non-typhoid Salmonella. Int J Antimicrob Agents 2004; 23 (6): 547–55.

(4) Fluit AC. Towards more virulent and antibiotic-resistant Salmonella? FEMS Immunol Med Microbiol 2005; 43 (1): 1–11.

(5) Aarestrup FM, Molbak K, Threlfall EJ. Is it time to change fluoroquinolone breakpoints for Salmonella spp.? Antimicrob Agents Chemother 2003; 47 (2): 827–9.

(6) Hall RM, Collis CM. Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updat 1998; 1 (2): 109–19.

(7) Rowe-Magnus DA, Mazel D. The role of integrons in antibiotic resistance gene capture. Int J Med Microbiol 2002; 292 (2): 115–25.

(8) Hall RM, Collis CM. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol Microbiol 1995; 15 (4): 593–600.

(9) Hall RM, Stokes HW. Integrons: novel DNA elements which capture genes by site-specific recombination. Genetica 1993; 90 (2-3): 115–32.

(10) Rowe-Magnus DA, Guerout AM, Ploncard P, Dychinco B, Davies J, Mazel D. The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. Proc Natl Acad Sci U S A 2001; 98 (2): 652–7.

 

(11) Nield BS, Holmes AJ, Gillings MR, Recchia GD, Mabbutt BC, Nevalainen KM, et al. Recovery of new integron classes from environmental DNA. FEMS Microbiol Lett 2001; 195 (1): 59–65.

(12) Mazel D, Davies J. Antibiotic resistance in microbes. Cell Mol Life Sci 1999; 56 (9-10): 742–54.

(13) Leverstein-van Hall MA, Blok HEM, Donders ART. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis 2003; 187 (2): 251–9.

(14) Ahmed AM, Nakano H, Shimamoto T. Molecular characterization of integrons in non- typhoid Salmonella serovars isolated in Japan: description of an unusual class 2 integron. J Antimicrob Chemother 2005; 55 (3): 371–4.

(15) Washington Winner JR, Allen S, Janda W, Koneman. E, Procop G, Schreckenberger P, et al. Color Atlas and Textbook of Diagnostic Microbiology. 6th ed. Philadelphia: Lippincott Williams and Wilkins Press; 2002.

(16) Yan H, Shi L, Yamasaki S, Li X, Cao Y, Li L, et al. A Plasmidic Class 1 Integron from Five Pseudomonas aeruginosa Clinical Strains Harbored aacA4 and Nonsense-mutated cmlA1 Gene Cassettes. J Health Sci 2007; 53 (6): 750–5.

(17) Marshall BM, Levy SB. Food Animals and Antimicrobials: Impacts on Human Health. Clin Microbiol Rev 2011;24 (4): 718–33.

(18) Mvzhnh L. use of antibiotics in poultry. Zoghie Esmail.Tehran: Gholeh; 2005.

(19) Carattoli A. Importance of integrons in the diffusion of resistance. Vet Res 2001; 32 (3-4): 243–59.

(20) Rowe-Magnus DA, Mazel D. Integron: natural tools for bacterial genome evolution. Curr Opin Microbiol 2001; 4 (5): 565–9.

(21) Fluit AC, Schmitz FJ. Resistance integrons and super integrons. Clin Microbiol Infect. 2004; 10 (4): 272–88.

(22) Helms M, Vastrup P, Gerner-Smidt P, Molbak K. Excess mortality associated with antimicrobial drug-resistant Salmonella typhimurium. Emerg Infect Dis 2002; 8 (5): 490–5.

(23) Majtaá novaá L , Majtaá n T, Majtaá n V. Detection of the Class 1 Integrons and SGI1 among Salmonella enterica Serovar Typhimurium DT104, U302, DT120, DT193, and Nontypable Human Isolates, Jpn. J Infect Dis 2010; 63 (4): 292-5.

(24) Toro M, Sáenz Y, Cercenado E, Rojo-Bezares B, García-Campello M, Undabeitia E, et al. Genetic characterization of the mechanisms of resistance to amoxicillin/clavulanate and third-generation cephalosporins in Salmonella enterica from three Spanish hospitals. Int Microbiol 2011; 14 (3): 173-81.

(25) Ranjbar R, Naghvny A, Panahi Y, Izadi M. Antibiotic sensitivity of Salmonella strains isolated from clinical cases to ten less current antibiotics used in the treatment of Salmonella infections. Journal of Infectious Diseases 2009; 14 (46): 41-5.

(26) Rajaei B, Siadat SD, Razavi M, Aghasadeghi M, Sepehri Rad N ,Badmasti F, et al. Expanding drug resistance through integrin acquisition in Salmonella spp. isolates obtained in Iran. Afr J Microbiol Res 2011; 5 (16): 2249-53.

(27) Soltan Dallal MM, Taremi M, Gachkar L, Modarressi S, Sanaei M, Bakhtiari R, et al. Characterization of antibiotic resistant patterns of Salmonella serotypes isolated from beef and chicken samples in Tehran. Jundishapur J Microbiol 2009; 2 (4): 124- 31.

(28) van Essen-Zandbergen A, Smith H, Veldman K, Mevius D. Occurrence and characteristics of class 1, 2, and 3 integrons in Escherichia coli, Salmonella and Campylobacter spp. in the Netherlands. J Antimicrob Chemother 2007; 59 (4): 746–50.

(29) Goldstein C, Lee M D, Sa´nchez S, Hudson C, Phillips B, Register B. Incidence of class1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother 2001; 45 (3): 723–36.

(30) Gebreyes W A, Thakur S. Multidrug-resistant Salmonella enterica serovar Muenchen from pigs and humans and potential interserovar transfer of antimicrobial resistance. Antimicrob Agents Chemother 2005; 49 (2): 503–11.

(31) Michael GB, Cardoso M, Schwarz S. Molecular anlysis of Salmonella enterica subsp. enterica serovar Agona iso- lated from slaughter pigs. Vet Microbiol 2006b; 112 (1): 43–52.

(32) Peirano G, Agerso Y, Aerestrup FM, dos Reis EM, dos Prazeres-Rodrigues D. Occurrence of integrons and antimicrobial resistance genes among Salmonella enterica from Brazil. J Antimicrob Chemother 2006; 58 (2): 305–9.

(33) Firoozeh F, Shahcheraghi F, Zahraei Salehi T, Karimi V, Aslani MM. Antimicrobial resistance profile and presence of class I integrongs among Salmonella enterica serovars isolated from human clinical specimens in Tehran, Iran. Iran J Microbiol 2011; 3 (3): 112-17.

(34) Naghoni A, Ranjbar R, Tabaraie B, Farshad S, Owlia P, Safiri Z, et al. High prevalence of integron-mediated resistance in clinical isolates of Salmonella enterica. Jpn J Infect Dis 2010; 63 (6) :417-21.

(35) Vo ATT, Duijkeren E, Fluit AC. Antibiotic Resistance, Integrons, and Salmonella Genomic Island 1 non-typhoid Salmonella in The Netherlands. Int J Antimicrob Agents 2006; 28 (3) :172-9.