جداسازی و شناسایی مولکولی یک سویه جدید از Microbacterium resistens، قادر به تحمل شرایط سخت

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناس ارشد میکروبیولوژی، دانشگاه اصفهان، ایران

2 استادیار میکروبیولوژی، دانشگاه اصفهان، ایران

چکیده

مقدمه: استفاده از باکتری­های مقاوم به اشعه، فرابنفش و دیگر شرایط سخت، برای پاک‏سازی زیستی و بازیابی فلزات موجود در زباله­های محیطی و صنعتی به خاطر توانایی بقا و کاتالیز عملکردی مطلوب تحت شرایط استرس بالای اشعه بسیار حائز اهمیت است.
مواد و روش‏‏ها: پس از غربال‏گری اولیه و ثانویه به‏وسیله تابش اشعه با لامپ UV، یک جدایه به‏دست آمد که براساس ویژگی­های ریخت‏شناسی و بیوشیمیایی، تعیین توالی ژن S rRNA16 و تحلیل فیلوژنتیک، شناسایی شد. به منظور مطالعه ویژگی‏های مقاومت جدایه فوق، سویه در معرض برخی شرایط سخت از قبیل اشعه فرابنفش (25 ژول)، خشکی (28 روز)، هیدروژن پراکسید (1 تا 5 درصد)، میتومایسین C (1 تا 8 میکروگرم)، غلظت­های مختلف نمک (5 تا 25 درصد) و مقادیر مختلف اسیدیته ‏(1تا 11) گذاشته و رشد یا بقای باکتری در محیط TGY به‏وسیله اسپکترومتری یا فلوسیتومتری ارزیابی شد.
نتایج: جدایه MG6 باکتری میله­ای گرم مثبت مقاوم به اشعه فرابنفش بود که توالی S rRNA16 آن 7/99 درصد ‏‏شباهت با Microbacterium resistens نشان داد. این شباهت با تحلیل فیلوژنتیک تائید شد. رشد بهینه سویه در اسیدیته 5 ‏و غلظت 5 درصد ‏‏کلریدسدیم دیده شد. همچنین به غلظت 1تا 4 درصد ‏‏ هیدروژن­پراکسید و 2 میکروگرم میتومایسین C مقاومت نشان داد. تحلیل میزان بقا نشان داد که این سویه در مقایسه با Deinococcus radioduransR1 مقاومت بالایی در برابر اشعه فرابنفش، ولی در برابر خشکی مقاومت متوسطی دارد.
بحث و نتیجهگیری: در این تحقیق، سویه جدیدی از M. resistensجداسازی شد که مقاوم به اشعه UV بود و تحمل برخی شرایط سخت مثل اسیدیته، عوامل اکسیدان و موتاژن، شوری و خشکی را نیز نشان داد. مقاومت سویه MG6 به اشعه UV قابل مقایسه با سویه مقاوم به اشعه D. radioduransR1 بود. تحقیق حاضر اولین گزارش درباره مقاومت به شرایط سخت سویه جدید M. resistens در ایران می­باشد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and molecular identification of a new strain of Microbacterium resistens, capable of tolerating the extreme conditions

نویسندگان [English]

  • Mahmoud Gholami 1
  • Zahra Etemadifar 2
1 M.Sc. of Microbiology, University of Isfahan, Iran
2 Assistant Professor of Microbiology, University of Isfahan, Iran
چکیده [English]

  Introduction: The use of resistant bacteria to radiation and other extreme conditions for bioremediation of the environmental and radioactive waste is very important due to their survivability and catalytic efficiency under high stress conditions .   Materials and methods: After primary and secondary screening by irradiation with UV lamp, one isolate was obtained and identified on the basis of morphological and biochemical characteristics, 16S rRNA gene sequencing and phylogenetic analysis. In the next step, the isolate was exposed to extreme conditions such as: UV-radiation (25J/cm2), desiccation (28 days), %1-5 hydrogen peroxide, mitomycin C (1-8µg), salinity (%5-25 NaCl) and different pHs (pH 1.0-11) during or after culture in TGY medium. Bacterial growth or survival was analyzed by spectrometry or flow cytometry .   Results: Isolated strain MG6 was an ultraviolet-resistant, Gram-positive, and rod shaped bacterium that its 16S rDNA sequences showed %99.69 similarity with Microbacterium resistens. This similarity was confirmed by phylogenetic analysis. Optimal growth rate of strain MG6 occurred at pH 5, %5 (w/v) NaCl and tolerated %1- 4 H2O2 and 2µg of mitomycin C. Analysis of viability indicated that this strain had highly resistance to UV-C radiation but moderately resistance to showed desiccation .   Discussion and conclusion : In this study, a new strain of M. resistens was isolated which was UV-resistant and showed tolerance to several extreme conditions such as: low pH, oxidant and mutagen agents, salinity and desiccation. The UV resistance of strain MG6 was comparable with Deinococcus radiodurans R1. This research was the first study on multiple extreme resistance of M. resistens new isolated strain (MG6) in Iran. Also this strain could be a candidate for the future researches such as bioremediation of radioactive waste sites .  

کلیدواژه‌ها [English]

  • UV
  • UV-resistance
  • Resistance
  • Microbacterioum resistens
  • Flow Cytometry
  • Extreme conditions

مقدمه

هم‏زمان با پیشرفت تکنولوژی، آلودگی­های زیست- محیطی نیز افزایش یافته‏اند. از جمله تدابیر امنیتی در برای‏‏ پاک‏سازی و حفظ محیط زیست، اجرای سیاست‏های لازم در طرح مدیریت زیستی می­باشد. فاضلاب­های رادیواکتیو و بازیابی فلزات مطلوب از قبیل اورانیوم، از جمله ترکیباتی هستند که امروزه نظر بسیاری از محققان را به خود جلب کرده­اند. استفاده از روش‏های شیمیایی به منظور پاک‏سازی زیستی بسیار پر هزینه است و در بیشتر موارد فاقد اختصاصیت مورد نیاز به منظور پاک‏سازی درست و بازیابی فلزات موجود در این جایگاه­ها می­باشد (1). اما میکروب­ها درجه بالایی از اختصاصیت را نشان می­دهند. محققان به تازگی از روش­های بیولوژیک برای‏‏ زدودن پساب­های رادیواکتیو و بازیابی فلزات از محیط زیست بهره برده اند. به دنبال تحقیقات انجام شده در سال 1992 مشخص شدکه باکتری­هایی نظیر Geobacter و جنس‏های مختلف Pseudomonas قادر به سمیت­زدایی از این گونه پساب­ها می­باشند. اما به علت این‏که حساسیت بالایی نسبت به پرتوهای یونیزان دارند در محیط­های رادیواکتیو کاربرد چندانی ندارند. استفاده از باکتری­های مقاوم به اشعه و دیگر شرایط سخت برای پاک‏سازی زیستی و بازیابی فلزات موجود در زباله­های رادیواکتیو به خاطر توانایی بقا و کاتالیز عملکردی مطلوب تحت شرایط استرس بالای اشعه بسیار مهم است (2). همچنین، باکتری‏های مقاوم به اشعه، مقاومت در خور توجهی به سایر شرایط سخت نشان می­دهند که از جمله می­توان به انواعی از استرس‏های شیمیایی و فیزیکی از قبیل خشکی، اشعه یونیزه­کنده، میتومایسین[1]C، هیدروژن پراکسید، شرایط اسیدی و قلیایی و غلظت بالای نمک NaCl اشاره کرد. رادیکال‏های آزاد اکسیژن[2] تولید شده توسط شرایط استرس به پروتئین، لیپید، نوکلئیک ­اسید و کربوهیدرات­ها آسیب رسانده و باعث شکستن DNA دو رشته­ای (DBSs)[3]می­شود.  خانواده داینوکوکاسه در محیط­های غنی از ترکیبات آلی از قبیل خاک، مدفوع حیوانات، لجن و ریزوسفر گیاهان یافت می­شوند. علاوه بر این در شرایط محیطی سخت از قبیل بیابان­ها، صخره‏ها، چشمه­های آب­گرم و مناطق منجمد نیز وجود دارند. همچنین، همه41 سویه­ی رادیودورانس که برای حساسیت به اشعه یونیزه کننده بررسی شده­اند، به تناسب حساس به خشکی نیز می­باشند. این مطلب نشان دهنده این است که مقاومت به اشعه و خشکی دو پدیده مرتبط می­باشند. D. radiodurans مقاومت در خور توجهی به عوامل مختلف ایجاد­کننده ROS، از جمله خشکی، اشعه یونیزان، اشعه UV، میتومایسینC و هیدروژن پراکسید، دارد و می­تواند دوز بالای اشعه یونیزه­کننده را که قادر به ایجاد تا 2000 قطعه در DNA ژنومی می­باشد تحمل کند. مقاومت این باکتری به خاطر مکانیسم­هایی می­باشد که از پروتئین­ها و دیگر ماکرومولکول­های سلولی در برابر استرس محافظت می­کنند و همچنین، فرآیندهای ترمیم DNA در این باکتری بسیار کارآمد هستند. سلول­هایی که در معرض اشعه فرابنفش قرار می­گیرند. علاوه بر تخریب DNA، قطعه ­قطعه شدن ژنوم نیز در آن‏ها‏‏ اتفاق می­افتد. همچنین، میزان سنتز پروتئین نیز در این سلول­ها کاهش می­یابد (3). برخلاف اشعه یونیزه کننده، اشعه فرابنفش حتی در دوزهای بالاتر از 1485 ژول بر متر مربع نیز قادر به ایجاد جهش نقطه­ای در داینوکوکوس رادیودوراس نمی­باشد. همچنین، فقدان DNA پلیمراز TLS در داینوکوکوس رادیودورانس باعث صحت بیشتر ترمیم آسیب­های ایجاد شده در اثر اشعه می­شود (4).

مشاهده شده است داینوکوکوس رادیودورانس در حالت خشک نسبت به سوسپانسیون آبی سه بار بیشتر مقاومت به اشعه را نشان می­دهد زیرا شرایط با آب کمتر باعث ایجاد رادیکال هیدروکسیل کمتری می شود (5). همچنین، باکتری‌های هوازی در مقابل نور UV و هیدروژن پراکسید مقاومت بیشتری نسبت به باکتری­های میکروآئروفیل‌ها نشان داده‌اند (6). به طور کلی در باکتری­هایی که در معرض استرس اکسیداتیو قرار گرفته­اند میزان کربونیلاسیون پروتئین­ها افزایش می­یابد و ارتباط معکوسی با میزان بقا دارد. با وجود این، این میزان در باکتری­های مقاوم به اشعه فرابنفش در مقایسه با سایر ارگانیسم­های حساس به اشعه بسیار پایین­تر می­باشد (7). کربونیلاسیون پروتئین­ها به عنوان یک آسیب اکسیداتیو رایج شناخته می­شود و بیشتر به عنوان یک نشانگر زیستی استرس اکسیداتیو استفاده می­شود. این فرآیند به تغییر فعالیت عملکردی و برهم کنش پروتئین‏ها منجر می­شود که در نهایت باعث توقف فرآیندهای سلولی و مرگ سلول می­شود (8). طبق مطالعات انجام شده تیمار اولیه باکتری­های مقاوم به اشعه، با میزان کمتر H2O2 برای مدت کوتاهی مقاومت ‌آن را در دوزهای بالاتر اشعه افزایش می‌دهد. درواقع بیانگر آن است که باکتری­ها می­توانند پاسخ‌های خود را در مقابل این استرس سازگار کنند (9). باکتری­های مقاوم به اشعه از مکانیسم­های متعددی برای مقاومت در برابر اثرات کشنده رادیکال­های آزاد اکسیژن استفاده می­کنند که از جمله این استراتژی­ها می­توان به آنزیم‏های آنتی اکسیدانت، کاتالاز و سوپراکسید دیسموتاز اشاره کرد (10). درسال‌های گذشته، گونه‌ها و سویه‌های جدید زیادی از داینوکوکوس­های مقاوم به اشعه یافت شده است. بسیاری از این باکتری­ها در صحراهای ساهارا و تاکیماکان یافت شده اند. همچنین، داینوکوکوس‌های مقاوم به اشعه در محیط‌هایی مثل اتمسفر، قطب جنوب، آب‌های تازه، خاک‌های مختلف، ماهی‏های دریایی و چشمه‌های آب داغ جداسازی شده‏اند (11).

 از جمله باکتری­های دیگری که مقاوم به اشعه می‏باشند می­توان به Rubrobacter radiotolerans،
R. xylanophilus ،Methylobacterium radiotolerans ،Lactobacillus plantarum، Acinetobacter radioresistens ،Enterococcus faecium، Hymenobacter actinosclerus، Kineococcus radiotoleran و Kocuria rosea اشاره کرد (12). هدف از این پژوهش، جداسازی و شناسایی سویه­هایی با مقاومت بالا در برابر اشعه فرابنفش و دیگر شرایط استرس، به منظور استفاده و کاربرد آن‏ها‏‏ برای پاک‏سازی زیستی پساب­های محیطی و صنعتی در پروژه‏های آتی می­باشد.

 

مواد و روش‏ها

جداسازی و غربال‏گری باکتری­های مقاوم به اشعه

پس از جمع آوری نمونه­های خاک سطحی از ناحیه صخره‏های اطراف کوه صفه در جنوب شهر اصفهان که در برابر نور مستقیم خورشید قرار داشت، به منظور غنی‏سازی اولیه باکتری­های موجود در نمونه­ها، ابتدا یک گرم از هر نمونه به 50 میلی­لیتر محیط TGY برات (تریپتون 5گرم، عصاره مخمر 5گرم، گلوکز 1 گرم و K2HPO4 1 گرم در یک لیتر آب مقطر) تلقیح و به مدت سه روز در انکوباتور شیکردار در دمای 30 درجه سانتی‏گراد و 180 دور در دقیقه انکوبه شدند. به منظور غربال‏گری اولیه 100 میکرولیتر از نمونه­های غنی شده به پلیت TGY آگار تلقیح و با میله شیشه­ای سرکج پخش شدند. سپس، پلیت­ها پس از یک انکوباسیون اولیه در 30 درجه سانتی‏گراد به مدت 2 تا 4 ساعت برای‏‏ رویش اسپورها، در فاصله 14 سانتی‏متری از یک لامپ دارای تابش فرابنفش قرار گرفتند. میزان کل اشعه 15 ژول در نظر گرفته شد (13). پس از اشعه پلیت­ها به منظور اجتناب از ترمیم وابسته به نور در داخل فویل آلومینیومی پیچیده و به مدت سه تا ده روز در 30 درجه سانتی‏گراد انکوبه شدند. هم‏زمان با این کار یک پلیت حاوی محیط کشت TGY آگار نیز در زیر اشعه قرار داده و پس از اشعه بر روی آن کشت داده شد، تا از اثرات مهاری اجزای محیط کشت که در معرض اشعه فرابنفش قرار گرفته­اند، بر روی باکتری­ها اطمینان حاصل شود. در نهایت کلونی­های رنگی مقاوم به اشعه فرابنفش براساس مشخصات ظاهری کلونی از یکدیگر متمایز، جداسازی و خالص­سازی شدند. شناسایی اولیه توسط واکنش گرم و خصوصیات ریخت‏شناسی و بیوشیمیایی انجام شد. به منظور غربال‏گری ثانویه کلونی‏های جداسازی شده در مرحله اول، یک بار دیگر آزمایش مقاومت به اشعه فرابنفش با دوز نهایی 25 ژول برای این سویه­ها انجام شد (2). بدین‏منظور یک کشت شبانه از سویه­های جداسازی شده آماده شد، سپس 100 میکرولیتر از باکتری­های میانه فاز لگاریتمی معادل کدورت 5/0 مک فارلند به پلیت TGY آگار تلقیح و در فاصله 14 سانتی‏متری از اشعه فرابنفش قرار داده شدند (14). در مرحله غربال‏گری ثانویه, یک سویه مقاوم به اشعه فرابنفش غربال‏گری شد که به‏ شکل MG6 نام‏گذاری شد.

 

شناسائی مولکولی باکتری‌های انتخاب شده با تعیین توالی ژن SrRNA16

پس از بررسی‌های بیوشیمیائی، به منظور شناسائی دقیق باکتری‌ جداسازی شده از روش مولکولی واکنش زنجیره‌ای پلیمراز[4] (PCR) استفاده شد. ابتدا DNA در این باکتری با روش جوشاندن استخراج شد سپس به منظور تشخیص مولکولی از یک جفت پرایمر عمومی[5]استفاده شد. این پرایمر‌ها به دلیل درصد مناسب باز‌های G+C و همچنین، کارایی بالای آن‏ها‏‏ استفاده شد. به این منظور از یک قطعه 20 نوکلئوتیدی به عنوان پرایمر رفت[6]با نام 5´AACTGGAGGAAGGTGGGGAT3´( RW01) و یک قطعه 19 نوکلئوتیدی به عنوان پرایمر برگشت[7]با نام (DG74) 5´AGGAGGTGATCCAACCGCA3´ استفاده شد (15). با استفاده از آب دوبار تقطیر استریل فاقد نوکلئاز، حجم آن به 25 میکرولیتر رسانده شد. سپس واکنش PCR در طی 30 چرخه دمایی به‏ شکل: دمای دناتوراسیون اولیه به مدت 5 دقیقه در 95 درجه سانتی‏گراد فقط در سیکل اول، دمای دناتوراسیون به مدت 45 ثانیه در 94 درجه سانتی‏گراد، دمای اتصال پرایمرها به مدت 30 ثانیه در 54 درجه سانتی‏گراد، دمای تکثیر به مدت 45 ثانیه در 72 درجه سانتی‏گراد در و درنهایت دمای تکثیر نهایی به مدت 5 دقیقه در 72 درجه سانتی‏گراد انجام شد. در نهایت یک قطعه 370 جفت بازی به وسیله PCR تکثیر و به منظور تعیین توالی به شرکت بیونیر کره جنوبی ارسال شد. نتایج حاصل از تعیین توالی، به منظور مشخص شدن جنس و گونه سویه مورد نظر با توالی­های موجود در پایگاه اطلاعاتی NCBI و EMBL مقایسه شد و قرابت بالاتر از 98 درصد به عنوان جنس و گونه باکتری مجهول درنظر گرفته شد (2).

 

تحلیل فیلوژنتیک

به منظور تأیید نتایج بلاست، برای سویه MG6 درخت فیلوژنتیکی نیز ترسیم شد که در ابتدا 12 توالی با بیشترین شباهت با سویه MG6 انتخاب شدند. پس از هم‏ردیف‏سازی توالی‏ها در نرم افزار CLC Genomic Workbench، ویرایش‏های لازم بر روی توالی‏های هم‏ردیف شده انجام شد (16). در مرحله بعد درخت فیلوژنتیکی با استفاده از نرم افزار MEGA5 و برپایه روش Neighbor-Joining و با بوت استرپ[8] 1000 تکرار ترسیم شد. همچنین، فاصله ژنتیکی با روش Maximum Composite Likelihood محاسبه شد (17).

بررسی مقاومت به شرایط سخت در سویه­های جداسازی شده

سنجش میزان مقاومت به اشعه فرابنفش UV-C به کمک تکنیک فلوسایتومتری

کشت شبانه­ ای از باکتری­ در محیط TGY برات تهیه و سپس از باکتری‏های میانه فاز لگاریتمی معادل کدورت 5/0 مک فارلند در PBS آماده شد، سپس دو میلی­لیتر از هر نمونه به یک پتری­دیش استریل اضافه و به مدت 3 ساعت معادل 30 ژول بر سانتیمتر مربع، در فاصله 14 سانتیمتری از اشعه فرابنفش با طول موج 254 نانومتر قرار گرفت (2). پس از تابش اشعه محتویات هر پتری­دیش در 4000 دور به مدت 10 دقیقه سانتریفیوژ و رسوب باکتریایی هر نمونه در 5/0 میلی لیتر PBS حل شد. در نهایت به منظور بررسی درصد بقا از دستگاه فلوسایتومتری استفاده شد. بدین منظور برای رنگ آمیزی سلول­های زنده و مرده از رنگ رودامین 123 استفاده شد (18). برای تهیه محلول ذخیره این رنگ 5 میلی­گرم از این رنگ در 5 میلی­لیتر اتانول حل شد. محلول رودامین 123 نسبت به نور حساس می­باشد و برای‏‏ جلوگیری از انجام واکنش نوری، لوله آزمایش حاوی این محلول به‏وسیله فویل آلومینیومی کاملاً پوشیده و در منفی20 درجه سانتی‏گراد قرار داده شد. و این استوک برای هربار استفاده به نسبت 1 به 100 در PBS رقیق شد. سپس 400 میکرولیتر به 100 میکرولیتر از سوسپانسیون باکتریایی افزوده شد و به مدت 10 دقیقه در تاریکی در دمای محیط قرار داده شد در نهایت به منظور بررسی میزان بقا از تکنیک فلوسایتومتری استفاده شد (19). همچنین، برای محاسبه میزان کاهش باکتری‏ها در برابر اشعه، شاهد بدون اشعه هم در نظر گرفته شد. لازم به ذکر است که طول موج تحریکی یا جذبی رودامین123، 560 507 تا 560 نانومتر می‏باشد و همچنین، طول موج نشر این رنگ در محدوده 529 تا 580 نانومتر می­باشد.

سنجش میزان مقاومت به خشکی به کمک تکنیک فلوسایتومتری

برای سنجش مقاومت این باکتری­ نسبت به خشکی از میکروپلیت­های 96 چاهکه استفاده شد. برای این منظور برای تلقیح چاهک­های میکروپلیت از باکتری‏های میانه فاز لگاریتمی معادل کدورت 5/0 مک­فارلند استفاده شد. برای بررسی مقاومت به خشکی در هر چاهک 50 میکرولیتر سوسپانسیون باکتریایی تلقیح و به مدت چهار هفته در 30 درجه سانتی‏گراد قرار داده شد (20). سپس به منظور بررسی درصد بقا از دستگاه فلوسایتومتری استفاده شد. که ابتدا پس از این مدت محتویات هر چاهک میکروپلیت به طور کامل در 50 میکرولیتر PBS حل شد و سپس به کمک PBS حجم آن به 5/0 میلی لیتر رسانده شد. در این مرحله برای رنگ آمیزی سلول­های زنده و مرده از رنگ رودامین 123 استفاده شد. که از استوک رقیق شده ردامین 400 میکرولیتر به 100 میکرولیتر از سوسپانسیون باکتریایی افزوده شد، و به مدت 10 دقیقه در تاریکی در دمای محیط قرار داده شد، در نهایت به منظور بررسی درصد بقا از تکنیک فلوسایتومتری استفاده شد (19).

 همچنین، میزان درصد کاهش باکتری­ در اثرمجاورت با ماده ضدمیکروبی طبق فرمول زیر محاسبه شد.

 

دراین فرمول A درصد باکتری­های زنده پس از استرس خشکی و اشعه و B درصد باکتری­های زنده درنمونه شاهد می­باشد.

سنجش میزان مقاومت به هیدروژن پراکسید و میتومایسین C

برای انجام این آزمایش از روش کدورت سنجی و دستگاه خواننده الایزا استفاده شد. برای این کار در ابتدا محلول‏هایی با غلظت­های مختلف هیدروژن پراکسید (1، 2، 3، 4 و 5 درصد ‏‏، بترتیب معادل 3/0، 58/0، 89/0، 18/1 و 46/1 مولار) آماده شد و سپس اسیدیته ‏بر روی 2/7 تنظیم شد. در ابتدا به همه چاهک­ها 100 میکرولیتر محیط کشت تریپتیک سوی برات (TSB) افزوده شد و چاهک­های ردیف A برای اندازه­گیری کدورت محیط کشت­ها لحاظ شد و برای بررسی کدورت حاصل از رشد باکتری کدورت ردیف A از آن‏ها‏‏ کسر شد. سپس 50 میکرولیتر از غلظت­های مختلف هیدروژن پراکسید به این ترتیب که در یک ردیف 12 تایی، در چاهک شماره 1 و 2 مقدار 50 میکرولیتر از سرم فیزیولوژی 9/0 درصد ریخته و به عنوان شاهد مثبت در نظر گرفته شد. به ترتیب در چاهک­های بعدی 50 میکرولیتر از غلظت­های مذکور هیدروژن پراکسید با دو تکرار اضافه شد. به این شکل که، ستون شماره 1 و 2 از تمام ردیف­ها دارای محیط کشت بدون هیدروژن پراکسید، ستون شماره 3 و 4 از تمام ردیف­ها دارای محیط کشت با غلظت یک درصد هیدروژن پراکسید می­باشند. به همین نحو با پیشروی در هر ردیف غلظت هیدروژن پراکسید افزایش داده شد. در مرحله بعد به هر چاهک 50 میکرولیتر از سوسپانسیون باکتریایی با کدورت معادل 5/0 مک فارلند اضافه شد. پس از آن درب میکروپلیت­ها گذاشته و دور آن‏ها‏‏ با پارافیلم بسته شد و به مدت 30 دقیقه بر روی شیکر قرار داده شد و سپس با توجه به دمای مطلوب رشد باکتری مورد آزمایش میکروپلیت­ها به مدت 24 تا 48 ساعت در 30 درجه سانتی‏گراد گرماگذاری شدند. سپس جذب نوری چاهک­ها در طول موج 630 نانومتر با استفاده از دستگاه خواننده الایزا قرائت شد و رشد یا عدم رشد در آن‏ها‏‏ بررسی شد. همچنین، به منظور بررسی مقاومت به میتومایسین C پس از آماده کردن محلول‏هایی با غلظت­های مختلف میتومایسین C (1، 2، 4، 6 و 8 میکروگرم بر میلی­لیتر) سایر مراحل مشابه روش بالا انجام شد (21). لازم به ذکر است که برای جلوگیری از تغییر غلظت هیدروژن پراکسید و میتومایسین C برای تهیه 5/0 مک فارلند باکتری­ از سرم فیزیولوژی استفاده نشد، بلکه از محیط TSB برات با غلظت هیدروژن پراکسید و میتومایسین C مشابه استفاده شد.

بررسی اثر غلظت­های مختلف NaClو مقادیر مختلف اسیدیته ‏بر روی رشد سویه MG6­

برای انجام این آزمایش از روش کدورت سنجی و دستگاه خواننده الایزا استفاده شد. برای این کار محیط کشت تریپتیک سوی برات با غلظت­های مختلف NaCl (0 ‏‏، 5 ‏‏، 10‏‏، 15 ‏‏، 20 ‏‏ و 25 درصد ‏‏) و مقادیر مختلف اسیدیته ‏(1، 3، 5، 7، 9 و 11) آماده شد و سایر مراحل کار مشابه مرحله قبلی انجام شد.

 

مطالعات آماری

برای تجزیه و تحلیل آماری داده­ها از آزمون تحلیل واریانس (GLM-unvariate) و برای مقایسه میانگین­ها از آزمون دانکن استفاده شد. اندازه کمتر از 05/0 به عنوان سطح معنی­داری در نظر گرفته شد (22).

 

نتایج

جداسازی، شناسایی مولکولی و فیلوژنتیکی سویه جداسازی شده MG6

خاک مناطق بیابانی با توجه به اینکه در معرض نور شدید آفتاب قرار دارند نمونه مناسبی برای جداسازی باکتری‏های مقاوم به اشعه فرابنفش می باشند. پس از جمع آوری نمونه‏ها، غربال‏گری اولیه و در نهایت غربال‏گری ثانویه, یک سویه با مقاومت بالا به اشعه فرابنفش جداسازی شد که به‏ شکل MG6 نام‏گذاری شد و خصوصیات اولیه سویه­ جدا شده با استفاده از آزمایش­های بیوشیمیایی و ویژگی­های میکروسکوپی (ریخت‏شناسی و واکنش گرم) و ماکروسکوپی (رنگ کلونی) تعیین شد (23). که مشخص شد یک باکتری گرم مثبت با کلونی‏های زرد رنگ، هوازی، میله ای شکل و بدون اسپور می باشد. در مرحله بعد به منظور شناسایی مولکولی سویه مورد نظر یک قطعه 370 جفت بازی توسط واکنش PCR تکثیر و تعیین توالی شد. سپس به منظور شناسایی جنس و گونه سویه مورد نظر، نتایج حاصل از تعیین توالی با سایر توالی‏های موجود در بانک ژنی بلاست شد و درنهایت به منظور شناسایی دقیق تر این سویه درخت فیلوژنی هم برای این سویه ترسیم شد (شکل 1). مقیاس مربوط به درخت فیلوژنی بیانگر تعداد جایگزینی نوکلئوتیدی در هر جایگاه مقایسه شده می باشد. در نهایت، توالی ژن S rRNA16 برای این سویه باکتریایی که از لحاظ مولکولی و فیلوژنتیکی با باکتری Microbacteriumresistens بیشترین شباهت (7/99 درصد‏‏) را نشان داد، با شماره دسترسی JX666609 در بانک ژنی NCBI ثبت نهایی شد.

 

 

شکل 1- درخت فیلوژنی مربوط به سویه جداسازی شده MG6 با استفاده از نرم افزار MEGA5 و براساس روش

Neighbor-Joining (مقیاس بیانگر 5 جایگزینی در هر 1000 نوکلئوتید می باشد.)


بررسی اثر غلظت‏های مختلف نمک NaCl و مقادیر مختلف اسیدیته ‏بر روی رشد سویه MG6

پس از بررسی اثر غلظت­های مختلف نمک کلرید سدیم بر روی رشد این سویه نتایج نشان داد که این سویه مقاومت بسیار بالایی به نمک NaCl نشان می­دهد به طوری­که حتی غلظت 25 درصد نمک هم باعث مهار رشد این سویه نشد. همچنین، طبق نتایج بدست آمده بهینه رشد این سویه در غلظت 5 درصد نمک مشاهده شد (شکل 2). همچنین، ملاحظه شد که این سویه در مقادیر اسیدیته ‏3 تا 11 قادر به رشد می­باشد به طوری­که بهینه رشد را اسیدیته ‏5 نشان می­دهد. از طرفی اسیدیته1 باعث مهار رشد این سویه شد.

 

 

شکل 2- بررسی اثر غلظت‏های مختلف نمک NaCl و مقادیر مختلف اسیدیته ‏بر روی رشد سویه MG6

 

تحلیل میزان بقا پس از تابش اشعه فرابنفش و اثر تنش خشکی به کمک تکنیک فلوسایتومتری

پس از بررسی اثر 25 ژول اشعه فرابنفش بر روی باکتری­ جداسازی شده در این پژوهش، بر طبق نتایج بدست آمده سویه R1 و MG6 به عنوان مقاوم­ترین سویه نسبت به اشعه فرابنفش شناخته شدند. به طوریکه نوک قله مربوط به شدت فلوروسنس در همه سویه‏ها در محدوده100 تا 1000 قرار دارد که بیانگر تعداد بیشتر سلول­های مثبت یا زنده در مقایسه با نمونه شاهد در این دو سویه می­باشد (شکل3، A, D, G). درحالی که در مورد سویه اشرشیا کلای نوک قله مربوط به شدت فلوروسنس در محدوده بین 10 تا 100 قرار دارد که بیانگر کاهش بالای تعداد سلول‏های زنده می باشد (شکل 3، B, E, H). از طرفی دیگر با توجه به این‏که میزان کاهش بقا در سویه R1، 2 درصد بود. بنابراین، می­توان نتیجه گرفت که 98 درصد سلول­ها زنده مانده‏اند که این میزان برحسب شاخص D، معادل D98 خواهد بود. همچنین، میزان مقاومت در سویه MG6 و سویه اشرشیاکلی برحسب شاخص D به ترتیب: D88 و D52 تعیین شد (شکل 4). طبق نتایج به‏دست آمده سویه MG6 مقاومت بسیار بالایی را در برابر تابش فرابنفش در مقایسه با سویه اشرشیاکلی نشان داد. اما در مقایسه با سویه R1 میزان مقاومت به طور جزئی کاهش یافت. همچنین، پس از بررسی اثر تنش خشکی (28 روز در 30 درجه) بر روی سویه جداسازی شده در این پژوهش، نتایج نشان داد که سویه MG6 در مقایسه با سویه R1 مقاومت کمتری نسبت به تنش خشکی نشان داد و سویه اشرشیاکلی کمترین میزان مقاومت به خشکی را داشت. به طوری که نتایج حاصل از تحلیل میزان بقا به کمک فلوسایتومتری در مورد سویه شاهد R1 نشان داد که نوک قله مربوط به شدت فلورسنس پس از تنش خشکی در محدوده­ی 10 تا100 قرار دارد که بیانگر کاهش تقریبا 10 برابری، تعداد سلول­های مثبت یا زنده می باشد درحالی که نوک قله مربوط به نمودار شدت فلورسنس در مورد نمونه تیمار شده باخشکی در دو سویه MG6 و اشرشیا کلای در محدوده­ی 10 قرار دارد (شکل3، C, F, I). که بیانگر کاهش صد برابری شدت فلورسنس سلول­های زنده در مقایسه با نمونه شاهد می­باشد.همچنین، میزان بقا برحسب شاخص D در سه سویه R1، MG6 و اشرشیا کلای به ترتیب معادل D52، D6 و D1 خواهد بود (شکل 4). مطالعات اخیر نشان داده است که در سویه‏های مقاوم به اشعه ارتباط نزدیکی بین مقاومت به اشعه و خشکی وجود دارد بنابراین، مقاومت به خشکی نیز در سویه MG6 بررسی شد. اما برطبق نتایج بدست آمده سویه MG6 با توجه به این‏که مقاومت بسیاربالایی در برابر اشعه فرابنفش نشان داد اما مقاومت کمتری را نسبت به تنش خشکی در مقایسه با سویه R1 نشان داد. که این ممکن است به این علت باشد که بین سیستم‏های درگیر در مقاومت به اشعه و خشکی در سویه R1 ارتباط نزدیکی وجود دارد. درحالی­که سویه MG6 با توجه به اینکه مقاومت بالاتری در برابر اشعه داشت، اما با وجود این به شدت نسبت به خشکی حساسیت نشان داد.

 

 

                 

شکل 3- بررسی شدت فلوروسنس پس از 25 ژول اشعه فرابنفش و 28 روز تنش خشکی بر روی سویه MG6 در مقایسه با دو سویه شاهد مقاوم DeinococcusradioduransR1 و شاهد حساس E. coli به کمک تکنیک فلوسایتومتری

 

شکل 4- بررسی درصد بقا پس از 25 ژول اشعه فرابنفش و 28 روز تنش خشکی بر روی سویه MG6 در مقایسه با سویه‏های شاهد DeinococcusradioduransR1 و E. coli به کمک تکنیک فلوسایتومتری

 


بررسی میزان مقاومت به هیدروژن پراکسید و میتومایسن C

پس از بررسی اثر غلظت­های مختلف هیدروژن پراکسید بر روی رشد باکتری­جداسازی شده، نتایج این طور نشان داد که در جذب نوری بین باکتری­‏های شاهد و تیمار شده با هیدروژن پراکسید تفاوت معنی­دار وجود دارد (شکل 5). به طوری که باکتری­های تیمار شده با هیدروژن پراکسید جذب نوری کمتری نسبت به شاهد نشان می­دهند. همچنین، جذب نوری در غلظت­های مختلف هیدروژن پراکسید و نیز در باکتری­های مختلف متفاوت است. به طوری­که نتایج حاصل از آزمون تحلیل واریانس نشان داد، که هم غلظت هیدروژن پراکسید و هم نوع باکتری در میانگین جذب نوری موثر می­باشد و برهم­کنش متقابل بین غلظت­های مختلف هیدروژن پراکسید و باکتری­های مختلف نیز معنی­دار است
(P value<0/05). همچنین، آزمون دانکن نیز نشان داد که میانگین جذب نوری در غلظت­های مختلف هیدروژن پراکسید و نیز در باکتری­های مختلف اختلاف معنی­داری دارد (P value<0/05). نتایج آماری بدست آمده برای میتومایسن C هم مشابه اثر هیدروژن پراکسید بر روی رشد باکتری‏ها بود. بر طبق این نتایج، سویه MG6 نسبت به غلظت­های 1 تا 4 درصد در مقایسه با سویه D. radiodurans مقاومت بسیار خوبی نشان داد اما در غلظت 5 درصد هیدروژن پراکسید مقاومت در سویه مورد نظر به شدت کاهش یافت. درحالی که سویه D. radiodurans در غلظت 5 درصد هیدروژن پراکسید هم به رشد خود ادامه داد (شکل 5). همچنین، مقاومت به میتومایسین C در این سویه مشابه داینوکوکوس رادیودورانس بود به طوری که هر دو سویه به غلظت 2 میکروگرم از این ترکیب مقاومت نشان دادند ولی غلظت‏های بالاتر اثر مهاری بر روی رشد این دو سویه داشت (شکل 6). مقایسه میانگین‏ها با آزمون دانکن نشان داد که در بین غلظت­های مختلف میتومایسین C، به جز در غلظت­های 4تا 8 میکروگرم، اختلاف معنی داری وجود داشت (P value<0/05).

 

 

 

شکل 5-میزان مقاومت به غلظت‏های مختلف هیدروژن پراکسید در سویه MG6 در مقایسه با DeinococcusradioduransR1

 

 

شکل 6-بررسی مقاومت به غلظت‏های مختلف میتومایسن C در سویه MG6 در مقایسه با Deinococcus radiodurans R1

 


بحث و نتیجه‏گیری

بر طبق نتایج بدست آمده باکتری­هایی که مقاومت بالایی در برابر اشعه فرابنفش و خشکی نشان می­دهند قادر به تحمل مقادیر بالای نمک نمی­باشند. از طرف دیگر باکتری­هایی که مقاومت متوسطی به اشعه فرابنفش و خشکی نشان می دهند قادر به تحمل مقادیر بالای نمک می­باشند که این نتایج با نتایج بدست آمده توسط شوکلا و همکاران[ix] همخوانی داشت (14). در واقع می‏توان گفت بین سیستم­های درگیر در مقاومت به اشعه و خشکی و تحمل نمک ارتباطی وجود ندارد. اما با وجود این هالوباکتریوم یک آرکئای نمک دوست است که در غلظت بالای نمک نزدیک به حد اشباع رشد می‏کند و قادر به تحمل دوز بالای اشعه گاما (D10 پس از 5 کیلوگری) می­باشد و میزان بقا پس از 20 روز خشکی، D25 می­باشد (20).

رودامین 123 یک رنگ فلورسنت کاتیونی است که می­تواند درون باکتری­های زنده نفوذ کند (به علت بار منفی سطح درونی غشا) و درون سلول تجمع یابد. در این حالت سلول­های زنده که رنگ درون آن‏ها‏‏ تجمع یافته دارای جذب در محدوده 525 نانومتر هستند و می‏توان درصد آن‏ها‏‏ را با استفاده از روش فلوسیتومتری تعیین نمود.

در سال 2010 زهنگ و همکاران[x] یک سویه جدید از میکروباکتریوم رادیودورانس[xi] را جداسازی و شناسایی کردند که مقاومت در خور توجهی در برابر اشعه فرابنفش نشان می­داد (24). در تحقیقی دیگر که بر روی سویه میکروباکتریوم ماریتیپیکوم[xii] انجام شد، این سویه به عنوان یک سویه مقاوم به اشعه گاما معرفی شد (25-27). در مطالعه دیگری که توسط عثمان و همکاران بر روی باکتری­های مقاوم به اشعه انجام شد، مشاهده شد که پس از 200 ژول بر متر مربع از اشعه فرابنفش بر روی باکتری­های اسفینگوموناس تریوپری[xiii] و بریوندیموناس دایمینوتا[xiv] میزان بقا 6 برابر کاهش یافت، درحالی­که باکتری‏های میکروباکتریوم اسکلیفری[xv] و اگزیگوباکتریوم استیلیکوم در برابر همین میزان اشعه 3 برابر کاهش در میزان بقا نشان دادند. همچنین، نتایج نشان داد که میکروباکتریوم اسکلیفری، میکروباکتریوم آربوریکنس[xvi] و اگزیگوباکتریوم استیلیکوم پس از 1000 ژول اشعه فرابنفش هم توانایی بقا دارند. (28).

شوکلا و همکاران[xvii] در تحقیقی که در سال 2007  بر روی باکتری­های مقاوم به اشعه انجام دادند، دریافتند، باکتری­هایی که به 15 روز خشکی مقاومت بالایی نشان داده­اند به غلظت 5 میلی­مولار هیدروژن پراکسید نیز در مقایسه با سویه­های حساس مقاومت بالاتری نشان می‏دهند (14). در سال 2002 تسوجی و همکاران[xviii] دریافتند که پیش تیمار با غلظت­های پایین فلزات سنگین از قبیل جیوه، سرب و کادمیم به مقاومت به غلظت­های بالاتر هیدروژن پراکسید منجر می‏شود (29). همچنین، باتوت و همکاران[xix] در سال 2006 در تحقیقی که بر روی تغییرات فیزیولوژیکی غشا پس از تیمار با هیدروژن پراکسید انجام دادند به این نتیجه رسیدند، که یکی از عوامل موثر در مقاومت باکتری­های مختلف به استرس اکسیداتیو اختلاف در ویژگی­های غشا در باکتری­های مختلف می­باشد (18).

نتایج این تحقیق نشان می دهد که باکتری
M. resistens در مقایسه با D. radiodurans R1، مقاومت بسیار بالایی در برابر اشعه فرابنفش دارد، درحالی که نسبت به خشکی در مقایسه با سویه R1 مقاومت متوسطی را نشان می­دهد. همچنین، مقاومت بالایی به دیگر شرایط سخت از قبیل هیدروژن پراکسید، میتومایسینC، غلظت بالای نمک و مقادیر مختلف اسیدیته ‏داشت. مقاومت چندگانه ممکن است به خاطر سیستم‏های ترمیمی قوی، آنزیم‏های آنتی اکسیدانت از قبیل کاتالاز و پراکسیداز و رنگیزه کاروتنوئیدی باشد. براساس نتایج بدست آمده این سویه کاندید مناسبی برای مطالعات آینده از قبیل پاک‏سازی زیستی پساب‏های آلوده صنعتی و محیطی می باشد.

 

 

 

 

 

 

 

پیوست‏ها

انحراف معیار میانگین­ها در نمودارهای مربوط به رشد سویه­ها در شرایط سخت مورد آزمایش

 

سویه باکتری

میکروباکتریوم رزیستنس MG6

NaCl  (درصد‏‏)

SD

0

037/0

5

082/0

10

071/0

15

035/0

20

013/0

25

051/0

 

سویه باکتری

میکروباکتریوم رزیستنس MG6

pH

SD

1

044/0

3

031/0

5

057/0

7

056/0

9

064/0

11

078/0

 

سویه باکتری

دینوکوکوس رادیودورانس R1

میکروباکتریوم رزیستنس MG6

H2O2(درصد)

SD

SD

0

123/0

086/0

1

023/0

056/0

2

042/0

020/0

3

031/0

031/0

4

015/0

020/0

5

077/0

017/0

 

سویه باکتری

دینوکوکوس رادیودورانس R1

میکروباکتریوم رزیستنس MG6

MMC (mg)

SD

SD

0

078/0

186/0

1

022/0

016/0

2

061/0

028/0

4

083/0

049/0

6

071/0

028/0

8

013/0

044/0

 



[1]. MitomycinC

[2]. Reactive oxygen species (ROS)

[3]. Double-strand DNA breaks (DSBs)

[4]. Polymerase chain reaction

[5]. Universal

[6]. Forward

[7]. Reverse

[8]. Bootstrap

[ix].  Shukla et al.

[x]. Zhang et al.

[xi]. Microbacterium radiodurans

[xii]. Microbacterium maritypicum

[xiii]. Sphingomonas trueperi

[xiv]. Brevundimonas diminuta

[xv]. Microbacterium schleiferi

[xvi]. Microbacterium arborescens

[xvii]. Shukla et al.

[xviii]. Tsuji et al.

[xix]. Baatout et al.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

References

(1) Venkateswaran A, McFarlan SC, Ghosal D, Minton KW, Vasilenko A, Makarova K, et al. Physiologic determinants of radiation resistance in Deinococcus radiodurans. Appl Environ Microbiol. 2000; 66 (6) :2620-6.

(2) Asgarani E, Soudi MR, Borzooee F, Dabbagh R. Radio-resistance in psychrotrophic Kocuria sp. ASB 107 isolated from Ab-e-Siah radioactive spring. J Environ Radioact. 2012; 113: 171-6.

(3) Slade D, Radman M. Oxidative stress resistance in Deinococcus radiodurans. Microbiol Mol Biol Rev. 2011; 75 (1) :133-91.

(4) Agostini HJ, Carroll JD, Minton KW. Identification and characterization of uvrA, a DNA repair gene of Deinococcus radiodurans. J Bacteriol. 1996; 178 (23) : 6759-65.

(5) Kilburn RE, Bellamy WD, Terni SA. Studies on a radiation-resistant pigmented Sarcina sp. Radiat Res. 1958;9 (2): 207-15.

(6) Arrage AA, Phelps TJ, Benoit RE, White DC. Survival of subsurface microorganisms exposed to UV radiation and hydrogen peroxide. Appl Environ Microbiol. 1993; 59 (11): 3545-50.

(7) Krisko A, Radman M. Protein damage and death by radiation in Escherichia coli and Deinococcus radiodurans. Proc Natl Acad Sci. 2010; 107 (32): 14373-7

(8) Daly MJ, Gaidamakova EK, Matrosova VY, Vasilenko A, Zhai M, Leapman RD, et al. Protein oxidation implicated as the primary determinant of bacterial radioresistance. PLoS Biol. 2007; 5(4) :e92.

(9) Slade D, Radman M. Oxidative stress resistance in Deinococcus radiodurans. Microbiol Mol Biol Rev. 2011; 75(1): 133-91.

(10)            Di Capua C, Bortolotti A, Farías ME, Cortez N. UV‐resistant Acinetobacter sp. isolates from Andean wetlands display high catalase activity. FEMS Microbiol Lett. 2011; 317(2): 181-9.

(11)            Mann JE. Recent advances in the development of Deinococcus spp. for use in bioremediation of mixed radioactive waste. 2009; MMG 449 Basic Biotech. 5 (1): 60-65.

 

(12)            Brooks BW, and R. G. E. Murray. Nomenclature for “Micrococcus radiodurans” and other radiation-resistant cocci: Deinococcaceae fam. nov. and Deinococcus gen. nov., including five species. Int J Syst Bacteriol. 1981; 31:353–360.

(13)            Chen M-Y, Wu S-H, Lin G-H, Lu C-P, Lin Y-T, Chang W-C, et al. Rubrobacter taiwanensis sp. nov., a novel thermophilic, radiation-resistant species isolated from hot springs. Int J Syst Evol Microbiol. 2004;54 (5): 1849-55.

(14)            Shukla M, Chaturvedi R, Tamhane D, Vyas P, Archana G, Apte S, et al. Multiple-stress tolerance of ionizing radiation-resistant bacterial isolates obtained from various habitats: correlation between stresses. Curr Microbiol. 2007; 54(2): 142-8.

(15)            Dutta S, Narang A, Chakraborty A, Ray P. Diagnosis of neonatal sepsis using universal primer polymerase chain reaction before and after starting antibiotic drug therapy. Arch Ped & Adol Med. 2009; 163 (1): 6.

(16)            Gholami M, Emtiazi G. Designing a new molecular marker for detection of heavy metal resistance genes in bacteria. Gene 3rd millennium. 2012;10 (2) :5.

(17)            Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mor Biol Evol. 1987; 4 (4): 406-25.

(18)            Baatout S, De Boever P, Mergeay M. Physiological changes induced in four bacterial strains following oxidative stress. Appl Biochem Microbiol. 2006; 42(4): 369-77.

(19)            Sarafnejad A, Siavoshi F, Safaralizadeh R, Masarat S, Khosravi F, Malekzadeh R, et al. Assessment of Helicobacter pylori  Viability by Flow Cytometry. Iran J Public Health. 2007; 36(1): 50-54.

(20)            Kottemann M, Kish A, Iloanusi C, Bjork S, DiRuggiero J. Physiological responses of the halophilic archaeon Halobacterium sp. strain NRC1 to desiccation and gamma irradiation. Extremophiles. 2005;  9(3): 219-27.

(21)            Holowachuk SA, Bal'a MF, Buddington RK. A kinetic microplate method for quantifying the antibacterial properties of biological fluids. J Microbiol Meth. 2003;55 (2): 441-6.

(22)            Kim D, Song H, Lim S, Yun H, Chung J. Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice. Radiat Phys Chem. 2007; 76 (7): 1213-7.

(23)            Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. Bergey’s manual of determinative bacteriology. Williams and Wilkins, Baltimore. 1994: 39-63.

(24)            Zhang W, Zhu H, Yuan M, Yao Q, Tang R, Lin M, et al. Microbacterium radiodurans sp. nov., a UV radiation-resistant bacterium isolated from soil. Int J Syst Evol Microbiol. 2010;  60 (11): 2665-70.

(25)            Williams PD, Eichstadt SL, Kokjohn TA, Martin EL. Effects of ultraviolet radiation on the Gram-positive marine bacterium Microbacterium maritypicum. Curr Microbiol. 2007; 55(1): 1-7.

(26)            Singh O, Gabani P. Extremophiles: radiation resistance microbial reserves and therapeutic implications. J Appl Microbiol. 2011; 110 (4): 851-61.

(27)            Kotelnikova SV, MacDonald R, Martine E, editors. Unusual resistance of marine Vibrio from Grenada to solar UV radiation. Caribbean Academy of Sciences 2008 Conference proceedings book; 2008.

(28)            Osman S, Peeters Z, La Duc MT, Mancinelli R, Ehrenfreund P, Venkateswaran K. Effect of shadowing on survival of bacteria under conditions simulating the martian atmosphere and UV radiation. Appl Environ Microbiol. 2008; 74 (4) :959-70.

(29)            Tsuji N, Hirayanagi N, Okada M, Miyasaka H, Hirata K, Zenk MH, et al. Enhancement of tolerance to heavy metals and oxidative stress in Dunaliella tertiolecta by Zn-induced phytochelatin synthesis. Biochem Biophys Res Commun. 2002; 293 (1): 653-9.