طراحی و بررسی مقایسه ای روش‏های مولکولی تشخیص سریع مقاومت به داروهای تزریقی ضد سل در سویه‏های کلینیکی میکوباکتریوم توبرکلوزیس

نویسندگان

1 دانشجوی کارشناسی ارشد میکروبیولوژی، دانشگاه آزاد اسلامی، واحد علوم تحقیقات کردستان، ایران

2 استادیار میکروب شناسی، دانشگاه آزاد اسلامی، واحد علوم تحقیقات کردستان، ایران

3 دانشجوی دکتری تخصصی ژنتیک مولکولی، مرکز تحقیقات سل و عفونی کودکان، دانشگاه علوم پزشکی اراک، ایران

4 استادیار باکتری شناسی پزشکی، دانشگاه علوم پزشکی اراک، ایران

5 دانشجوی کارشناسی ارشد میکروبیولو‍ژی، دانشگاه آزاد اسلامی، واحد علوم تحقیقات کردستان، ایران

6 دانشجوی دکتری تخصصی پزشکی مولکولی، مرکز تحقیقات پزشکی و مولکولی، دانشگاه علوم پزشکی اراک، ایران

چکیده

مقدمه: در این تحقیق، برای تشخیص سریع مقاومت به کانامایسین، آمیکاسین، کاپرئومایسین، چند روش مولکولی طراحی و مقایسه شدند.
مواد و روش‏‏ها: از میان 120 سویه کلینیکی مایکوباکتریوم توبرکلوزیس، 70 سویه برای بررسی موتاسیون‏های احتمالی انتخاب شدند. در روشPCR-RFLP ‏از آنزیم ajii برای تشخیص سویه وحشی و از آنزیمBstFNI برای شناسایی سویه موتانت استفاده شد. علاوه بر این، در طراحی روش آلل اسپسیفیک هم‏زمان (mAs PCR) از سه پرایمر اختصاصی برای تعیین حالت‏های وحشی و نیز موتان کدون‏های 1401 و 1402 استفاده شد. تعدادی از سویه‏ها تعیین توالی (سکوئنس) شدند.
نتایج: در روشPCR-RFLP ‏از میان 70 سویه مورد بررسی، با آنزیم BstFNI، 17 سویه موتان از میان 24 سویه مقاوم فنوتیپی و 44 سویه غیر موتان از 46 سویه، حساس تشخیص داده شدند. حساسیت این روش 83/70 و ویژگی آن 65/95 درصد بود. آنزیم ‏ajii از میان 52 سویه مورد بررسی، ‏12سویه موتان از میان 20 سویه مقاوم و29 سویه غیر موتان را از میان 32 سویه حساس فنوتیپی تشخیص داد. حساسیت این روش 60 و ویژگی آن 62/90 درصد بوده است. در روش آلل اسپسیفیک 23 سویه بررسی شدند. این روش قادر به تشخیص 3سویه موتان ازمیان6 سویه مقاوم و12 سویه غیرموتان ازمیان 17 سویه حساس فنوتیپی شد. حساسیت این روش50 و ویژگی آن 58/70 درصد بوده است. نتایج تعیین ترادفاثبات کننده صحت نتایج روش‏های مولکولی استفاده شده، بود.
بحث و نتیجهگیری: روشPCR-RFLP ‏با آنزیم BstFNI، به عنوان یک روش سریع در تشخیص مقاومت مایکوباکتریوم توبرکلوزیس به داروهای تزریقی خط دوم درمان سل پیشنهاد می‏شود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Designing and comparison study of rapid detection methods of resistance to injectable drugs in clinical strains of Mycobacterium tuberculosis

نویسندگان [English]

  • Fatemeh Salehi 1
  • Bahareh Rahimiyan Zarif Rahimiyan Zarif 2
  • Azam Ahmadi 3
  • Mohammad Arjomandzadegan 4
  • Toktam Polad 5
  • Mana Shojapour 6
1 M.Sc. student of Microbiology, Islamic Azad University, Science and Research Branch, Kordestan, Iran
2 Assistant Professor of Microbiology, Islamic Azad University, Science and Research Branch, Kordestan, Iran
3 Ph.D student of Molecular Genetics, Tuberculosis and Pediatric Infectious Research Center University of Medical Sciences, Arak, Iran
4 Ph.D student of Molecular Medicine, Research Center of Molecular Medicine, University of Medical Sciences, Arak, Iran
5 M.Sc. student of Microbiology, Islamic Azad University, Science and Research Branch, Kordestan, Iran
6 Assistant Professor of Medical Bacteriology, University of Medical Sciences, Arak, Iran
چکیده [English]

Introduction: In this study, some molecular methods were designed for rapid detection of resistance to kanamycin and amikacin.
Materials and methods: Among 120 clinical isolates of mycobacterium tuberculosis, 70 strains were selected for evaluation of possible mutations. A PCR-RFLP method was designed for detection of wild type (using enzyme ajii) and mutant from (BstFNI enzyme) of the isolates. Furthermore, allele specific method (as PCR) was designed for detection mutations in codons 1401 and 1402 gene rrs. Some selected isolates were sequenced.
Results: In PCR-RFLP method, among the 70 strains examined by BstFNI enzyme, could detect 17 mutant strains among 24 phenotypicaly resistant and 44 non-mutant isolates from 46 susceptible isolates. The sensitivity of this method was %70.83 and specificity was %95.65 on the other hand, 12 mutant from 20 resistant strains and 29 non-mutant strains from 32 susceptible strains were detected by AjiI enzyme. The sensitivity and specificity of this method was 60 and %90.62, respectively. In MAS PCR, 3 mutants from 6 resistant strains and 12 non-mutants from 17 resistant strains were detected. The sensitivity of this method was 50 and specificity was 70.58. Results of sequencing method confirmed the results of molecular methods.
Discussion and conclusion: PCR-RFLP method by BstFNI enzyme was the best method for rapid detection of Mycobacterium tuberculosis resistant to second-line injectable drugs and was recommended for routine use.

کلیدواژه‌ها [English]

  • Mycobacterium Tuberculosis
  • Kanamycin and Amikacin
  • Resistance
  • PCR-RFLP

مقدمه

سلیکبیماریعفونیبا ماهیتمزمنو بسیار مسریاستکهدر بیشتر موارد ناشیاز مایکوباکتریوم توبرکلوزیساست.شایع‏ترین محل درگیری آن ریه است، اما در یک سوم موارد سایر اعضا را نیز درگیر می‏کند (1). این بیماری شایع‏ترین بیماری کشنده به علت یک میکروب در تمام جهان است و یک سوم جمعیت جهان آلوده به این میکروب هستند. در هر سال نزدیک به 9 میلیون نفر مبتلا به سل می‏شوند. 5 تا 10 درصد کسانی که به میکروب سل آلوده اند مبتلا به این بیماری می‏شوند (3) و در هر سال نزدیک به 2 میلیون مرگ ناشی از این بیماری رخ می‏دهد (2).

پس از سال 1980 افزایش شدیدی در سویه‏های مقاوم به درمان در تمامی جهان مشاهده شد. مقاومت به یک دارو از سال‏ها قبل شناخته شده بود ولی با افزایش شدید مقاومت‏ها متاسفانه تعداد زیادی از این مقاومت‏ها به شکل مقاومت چند دارویی (حداقل مقاومت به دو داروی خط اولی بیماری سل یعنی ریفامپینو ایزونیازید) مشاهده شده است. میزان بروز سل مقاوم به چند دارو به سرعت در حال افزایش است و بروز تخمینی آن در کل جهان 460000 مورد در سال 2005 گزارش شده است. این میزان در بسیاری از کشورهای درحال توسعه به علت کمبود امکانات آزمایشگاهی و تشخیصی مناسب کمتر از میزان واقعیت تخمین زده می‏شود. در سال ۲۰۱۰ میزان بروز کل موارد سل در ایران، ۲۰ مورد به ازای یک‏صد هزار نفر جمعیت ثبت و گزارش شده است. همسایگی ایران با دو کشور افغانستان و پاکستان که در زمره ۲۲ کشور مطرح دنیا در زمینه سل هستند و همچنین عراق و کشورهای تازه استقلال یافته (با شیوع بالای سل مقاوم به چند دارو) ضرورت توجه بیشتر ما را به این بیماری متذکر می‏کند (3).

موضوع مهم در مورد بیماری سل چگونگی کنترل و پیشگیری از آن است (4 و 5). در حال حاضر گسترش سویه‏های با مقاومت گسترده و ظهور سویه‏های مقاوم به تمام داروها مشکلات اساسی در کنترل جهانی سل ایجاد کرده است. استفاده مناسب از داروهای ضد سل، برای درمان موثر سل مقاوم به چند دارو و پیشگیری از ایجاد سل با مقاومت گسترده ضروری است (6).

سل با مقاومت گسترده، یک نوع کمابیش نادری از سل مقاوم به چند دارو است که تقریبا مقاوم به تمام داروهای استفاده شده در درمان سل از جمله دو داروی خط اول درمان و داروهای خط دوم مانند فلوروکینولون‏ها و حد اقل یکی از سه داروی تزریقی کانامایسین، آمیکاسین و کاپرئومایسین است(7). در درمان این نوع از سل، آنتی بیوتیک‏های خط دوم درمان مانند آمینوگلیکوزیدها (کانامایسین و آمیکاسین) یا آنتی بیوتیک‏های پپتیدی (کاپرئومایسین) استفاده می‏شوند (8).

آنتی بیوتیک‏های خط دوم درمان باکتریسیدال بوده و از طریق تداخل با این جایگاه‏های ریبوزوم، اثر خود را اعمال و از سنتز پروتئین ممانعت می‏نمایند (5). درواقع کانامایسین و آمیکاسین به جز S rDNA16 از زیر واحد s30 متصل شده و با اتصالبهاینزیرواحدسبب اشتباهخواندنرمزهایژنتیکیمی‏شوند؛ بنابراین باعثافزایشسطوحپروتئین‏هاییباتاخوردگی اشتباهدرسلولودرنهایتمرگسلولمی‏شود (9، 10 و 13). مکانیسم فعالیت کاپرئومایسین در مایکوباکتریوم توبرکلوزیس به طور کامل مشخص نیست اما به نظر می‏رسد که از طریق تداخل در ترجمه و ممانعت از سنتز فنیل آلانین در ریبوزوم‏های باکتریایی اثر خود را اعمال می‏کند (11).

سویه‏های مقاوم به یک یا بیش از یک داروی تزریقی شامل موتاسیون‏هایی در نزدیکی انتهای ′3 ژن rrs (S rDNA16) شامل نواحی نوکلئوتیدی A1401G،C1402t ،G1484t ‏‏است (12، 16 و 17).

روش‏های موجود برای تشخیص سریع این داروها بیشتر مبتنی بر تعیین ترادف کدون‏های اصلی مرتبط با مقاومت هستند. به تازگی کیت‏های تجاری دراین رابطه به بازار ارائه شدند که با توجه به هزینه بری بالا،.مقبولیت عام در آزمایشگاه‏های مرکزی پیدا نکردند.

دراین تحقیق، سه روش مختلف مولکولی
 InHouse ‏برای تشخیص جهش‏ها درکدون‏های 1401 و 1402 ژن rrs طراحی شده و با روش تعیین توالی مقایسه شده اند.

 

مواد و روشها

این مطالعه از نوع توصیفی تحلیلی بوده و در مرکز تحقیقات سل و عفونی دانشگاه علوم پزشکی اراک انجام گرفته است.

سویه‏ها

صد و بیست سویه خلط مثبت و کشت مثبت با الگوهای مقاومت متنوع و سابقه شکست در درمان انتخاب شدند. از این میان تعداد 52 سویه مایکوباکتریوم توبرکلوزیس که به روش استاندارد طلایی‏‏ کشت (proportion) مقاومت به سه داروی تزریقی کانامایسین، آمیکاسین و کاپرئومایسین در آن‏ها تعیین شده بود، استفاده شدند.

استخراج DNA

تعدادی از کلونی‏های رشد کرده مایکوباکتریوم توبرکلوزیس بر روی محیط کشت لونشتاین جانسون برداشته و در 270 میکرو لیتر بافر TAE-1X محتوی 07/0 گرم، chelex100 حل شد. سپس به شدت ورتکس شده و در 95 درجه سانتی‏گراد به مدت 45 دقیقه حرارت دهی انجام شد. دوباره ورتکس کرده و به مدت 10 دقیقه در دور 14000 سانتریفوژ شد. سپس، با دقت DNA موجود در فاز رویی‏‏ جدا شده و دو بار دیگر سانتریفوژ تکرار می‏شود. در نهایت، سوپرناتانت محتوی DNA در فریزر نگه داری شد.

روش‏های مولکولی مورد استفاده

در این تحقیق، برای تعیین جهش در کدون‏های 1401 و 1402 ژن rrs روش‏های مولکولی زیر طراحی و استفاده شدند:

  1.  PCR-RFLP با کمک آنزیم BstFNI
  2. PCR-RFLP با کمک آنزیم Ajii
  3. آلل اسپسیفیک
  4. تعیین توالی[1]

نتایج فنوتیپی به عنوان استاندارد طلایی مقاومت و روش تعیین توالی به عنوان استاندارد طلایی روش‏های مولکولی استفاده شدند. در روش آلل اسپسیفیک از پرایمرهای اختصاصی برای تعیین حالت وحشی 1401 و 1402 استفاده شد. در روشPCR-RFLP ‏‏ازآنزیم ajii برای تعیین سویه‏های تیپ وحشی و از آنزیم ‏BstfNIبرای شناسایی سویه‏های موتانت استفاده به عمل آمد.

طراحی پرایمر

با توجه به جدید بودن روش‏های مولکولی مورد استفاده، پرایمر‏های مورد نیاز طراحی شدند. بدین منظور پرایمر‏ها با توجه به نوکلئوتید‏های هدف به گونه ای طراحی شدند که قادر به شناسایی‏‏ هر نوع موتاسیون باشند. علاوه بر این، نکات اصلی در طراحی پرایمر شامل موارد زیر در نظر گرفته شده و با کاهش و افزایش نوکلئوتید‏ها بهترین ترادف‏ها انتخاب شدند: طول پرایمر، درصد GC بین 60 تا 45، دلتا G پرایمر، جلوگیری از تشکیل ساختار‏های سنجاق سری، ممانعت از انتهای چسبان، افزایش درصد C یا A در انتهای 3 پرایمر، افزایش درصد ‏A و T در 3، پرهیز از (5')...GATC(3') و نیز (5')AC...GT(3') در 3، تشابه درصد GC درF ‏و R، انتخاب دمای ذوب بین 65 تا 70 درجه سانتی‏گراد و تشابه آن در هر دو پرایمر و در نهایت انتخاب دمای Annealing ‏بر اساس دمای ذوب.

 

 

جدول 1- پرایمرهای مورد استفاده برای روش‏های مختلف مولکولی

روش

پرایمرها

‏توالی (به شکل '3-'5)

∆G

GCدرصد

وزن مولکولی

گرم/ مول

نقطه ذوب

درجه سانتی‏گراد

طول

محصول

( زوج باز)

روش

‏PCR-RFLPو تعیین توالی

F-rrs

TCTCATGTTGCCAGCACGTAATG

39/0 تا 37/1+

8/47

6/7014

8/47

22

422

R-rrs

GAGGTGATCCAGCCGCAC

07/0 تا 88/0-

7/66

6/5509

8/58

آلل  1401

f1401

GCCTTGTACACACCGCCCGTCA

65/0 تا 25/1

6/36

3/6616

2/64

22

151

fm1401

GCCTTGTACACACCGCCCGTCG

3/0- تا 65/0

2/68

3/6632

65

22

151

R-rrs

GAGGTGATCCAGCCGCAC

07/0- تا 88/0-

7/66

6/5509

8/58

آلل 1402

fm1402

GCCTTGTACACACCGCCCGTCAT

65/0 تا 25/1

9/60

6/6920

9/63

23

151

R-rrs

GAGGTGATCCAGCCGCAC

07/0- تا 88/0-

7/66

6/5509

8/58

 


انجام PCR-RFLP

به منظور بررسی وجود موتاسیون در ژن rrs، پرایمر‏های اختصاصی ‏ F-rrsوR- rrs‏(جدول 1) بدین منظور طراحی شده و برای تکثیر یک قطعه ‏bp422 استفاده شدند.

برنامه واکنش PCR به شکل ‏زیر انجام شد. دناتوراسیون اولیه: 94 درجه سانتی‏گراد برای 3 دقیقه، 40 سیکل به شکل 94 درجه سانتی‏گراد برای 30 ثانیه، 56 درجه سانتی‏گراد برای 30 ثانیه، 72 درجه سانتی‏گراد برای 30 ثانیه و دمای پایانی 72 درجه سانتی‏گراد برای 10 دقیقه محصولات PCR در ژل آگاروز یک درصد الکتروفورز شدند و برای اندازه گیری باند‏ها از نشانگر مولکولی مناسب استفاده شد.

ترکیب مخلوط PCR شامل 2 میکرولیتر بافر، 5/. میکرولیتر MgCl2، 5/2 میکرولیتر جفت پرایمر‏های اختصاصی، یک میکرولیتر مخلوط دزوکسی نوکلئوتید‏های چهارگانه، 6/0 میکرولیتر آنزیم Taq پلیمراز و مقداری آب مقطر استریل در حجم نهایی‏‏ 25 میکرولیتر بود.

برای تعیین جهش‏ها درکدون‏های 1401، 1402 ژن rrs، محصول PCR برای انجام برش آنزیمی به دو روش استفاده شد:

(الف) آنزیم BstFNI

آنزیم BstFNI دارای سایت برش، (5-CG"CG-3) است. باند‏های مورد انتظار با کمک نرم افزار Genetix برای فراگمنت مورد نظر این آنزیم تعیین شدند. همان گونه که در شکل 1 مشاهده می‏شود، قطعات حاصل از برش محصول PCR، با کمک آنزیم BstFNI، در نمونه‏های غیر موتان 273 و 150 و در نمونه‏های موتان 130و143و150 هستند (شکل 1). محصولاتحاصلاز برش،با الکتروفورز روی ژل پلی‏آکریل آمید 8 درصد و رنگآمیزی نیترات نقره قابل مشاهده بودند.

برای انجام واکنش هضم، مخلوط 4 میکرولیتر محصول PCR، 2 میکرولیتر بافر، 1 واحد از آنزیم BstFNI و 13 میکرولیتر آب مقطر تهیه و در دستگاه ترموسایکلر ابتدا به مدت 3 ساعت در دمای 37 درجه سانتی‏گراد و سپس به مدت 20 دقیقه در دمای 65 درجه (برای غیرفعال شدن آنزیم) قرار داده شد.

 

 

 

شکل 1- برش قطعه bp422را توسط آنزیم BstFNI نشان می‏دهد . قطعه bp 422 طی هضم با این آنزیم در سویه‏های موتان قطعه 130، 143 و 150 را تولید و در سویه‏های فاقد موتاسیون قطعات 150 و 273 را تولید می‏کند

 

(ب) برش با کمک آنزیم Ajii

آنزیم ajii دارای سایت برش (5-CAC"TCG-3) بوده و باند‏های حاصل از برش در شکل2قابل مشاهده هستند. قطعات حاصل از برش محصول PCR ‏موجود توسط آنزیم ajii در نمونه‏های غیر موتان bp 292 و bp 131 و در نمونه‏های موتان bp 422 است. ترکیب مخلوط واکنش، شبیه ترکیب به آنزیم BstFNI مربوط بود. محصولاتحاصلاز برشبا الکتروفورز روی ژل پلی‏آکریل آمید 8 درصد و رنگآمیزی نیترات نقره بررسی شدند.

 

 

 

شکل 2- برش قطعه bp 422 را توسط آنزیم ajii نشان می‏دهد. قطعه bp 422 طی هضم با این آنزیم در سویه‏های موتان قطعه bp 422 را تولید و در سویه‏های فاقد موتاسیون قطعاتbp131 و bp 292 را تولید می‏کند.

 

روش آلل اسپسیفیک

برای روش آلل اسپسیفیک، 3 گروه پرایمر‏های اختصاصی طراحی شد. پرایمر‏هایی که به شکل فوروارد انتخاب شدند شامل F-1401، ‏F- 1401M و ‏F- 1402M بودند. استفاده آن‏ها با پرایمر R، برای حالت وحشی باند داخلی 157 را ایجاد نمود که درانجام آزمایش‏ها از آن‏ها استفاده شد.

برای تعیین جهش‏ها درکدون‏های 1401، 1402 ژن rrs برنامه pcr و مخلوط واکنش شبیه برنامه و ترکیب روش PCR-RFLP بود.

پرایمر‏های داخلی استفاده شده با پرایمر R، ایجاد باند داخلی 151 می‏کنند که در نهایت قطعات تکثیر شده روی ژل آگاروز یک درصد با GelRed الکتروفورز شد. در مقابل نور UV حاصل از ترانس لومیناتور، بررسی شدند.

 

 

شکل 3- نمایی ازطراحی پرایمر‏های داخلی ژن rrs برای روش آلل اسپسیفیک با استفاده از نرم افزار mega

 

 

تعیین توالی ژن

برای ارزیابی روش تعیین موتاسیون با سایر روش‏های مولکولی، از تعیین توالی، به عنوان استاندارد طلایی استفاده شد. در این روش، قطعه مورد نظر محتوی کدون‏های موتان، با انجام PCR با پرایمر‏های اختصاصی (ارائه شده در بند PCR-RFLP) تکثیر شد. محصول PCR، قطعهbp422 بود که پس از تخلیص برای تعیین توالی با دستگاه AppliedBiosystem به شرکت انگلستان فرستاده شد.

 

نتایج

نتایج PCR

انجام PCR ژن rrs روی تمامی نمونه‏های مورد مطالعه، باند bp 422 را ارائه نمود که نشان دهنده انتخاب صحیح پرایمر‏ها و تعیین برنامه مناسب آمپلی فیکاسیون بود.

نتایج RFLP-PCR

(الف) برش با کمک آنزیم ajii

در این روش محصول برش آنزیمی به کمک RFLP-PCR همان گونه که با نرم افزار Genetix پیش‏بینی شده بود، برای سویه‏های موتان باندbp422 و برای سویه‏های غیر موتان باند‏های bp 131 و ‏bp292 را ایجاد نمود.

از 120 سویه کلینیکی جدا شده از بیماران خلط مثبت و کشت مثبت، 52 سویه مایکوباکتریوم توبرکلوزیس با الگوی مقاومت متنوع برای بررسی با آنزیم ajii انتخاب شدند. که از این میان 20 سویه از نظر فنوتیپی مقاوم (4 نمونه MDR، 16 نمونه (XDR و 32 سویه از نظر فنوتیپی حساس (23 نمونه کاملا حساس و 8 نمونهMDR ‏و یک نمونهتک مقاومتی) به سه داروی تزریقی مذکور بوده اند.

نتیجه هضم قطعه bp 422 حاصل از PCR ژن rrs، در نمونه‏های مختلف متفاوت بوده والگو‏های متنوعی را نشان می‏دهد. نتایج این یافته‏ها در شکل 4 نشان داده شده است.

 

 

شکل 4- الگو‏های ‏RFLP ژن rrs پس از برش توسط آنزیم ajii در نمونه‏های غیر موتان قطعات حاصل از برش محصول PCR با آنزیمajii، bp 131 وbp292 و در نمونه‏های موتان باند bp422مورد انتظار است.  در شکل یاد شده نمونه‏های 2، 3 و4 ‏حساس بوده که دارای باند‏های 131 و 292 هستند و نمونه‏های 5 و6مقاوم فنوتیپی بوده که برای آن‏ها باند 422 قابل انتظار است.

آنزیم ajii به کمک روش ‏PCR-RFLPقادر به تشخیص 12 سویه موتان از میان20 سویه مقاوم فنوتیپی شد. همچنین از میان 32 سویه حساس فنوتیپی،29سویه غیر موتان توسط این آنزیم تشخیص داده شدند. حساسیت این روش 60 و ویژگی آن 62/90 درصد بوده است.

(ب) برش با کمک آنزیم BstFNI

نتیجه هضم قطعه bp 422 توسط آنزیم BstFNI ‏در نمونه‏های موتان و غیر موتان الگو‏های متفاوتی را برای نمونه‏های مختلف نشان داد. تمامی سویه‏های غیر موتان باند bp 273 و bp 150و سویه‏های موتان باند 130 و 143 و 150 را نشان می‏دهند (شکل 5).

 

 

شکل 5- الگوهای ‏RFLPژن rrs پس از برش توسط آنزیم bstfni، در نمونه‏های غیر موتان باند‏های، 273 و150 ‏‏و در نمونه‏های موتان باندهای 130 و 143 و 150 قابل مشاهده هستند. در شکل یاد شده نمونه‏های 3 و 2 حساس بوده که دارای باند‏های 150 و 273 هستند. نمونه 4 مقاوم فنوتیپی بوده که برای آن‏ها باند‏های 130 و 143 و 150 قابل انتظار است.

 

از 70 سویه مایکوباکتریوم توبرکلوزیس که برای بررسی با آنزیم BstFNI انتخاب شدند، 24 سویه از نظر فنوتیپی مقاومو 46 سویه از نظر فنوتیپی حساس به سه داروی تزریقی مذکور بوده اند.

آنزیم BstFNI به کمک روش PCR-RFLPقادر به تشخیص 17 سویه موتان از میان 24 سویه مقاوم فنوتیپی شد. این آنزیم از میان 46 سویه حساس فنوتیپی، 44 سویه غیر موتان را تشخیص نمود. به عبارت بهتر، حساسیت این روش 83/70 و ویژگی آن 65/95 درصد بود.

 

روش آلل اسپسیفیک

23 سویه مایکوباکتریوم توبرکلوزیس برای بررسی با روش آلل اسپسیفیک انتخاب شدند، که از این میان 6 سویه مقاوم فنوتیپی شامل: 2 نمونه MDR، 4 نمونه XDR و17 سویه حساس فنوتیپی (12سویه کاملا حساس و 3 نمونه ‏MDR و یک نمونه تک مقاومتی) بوده‏اند.

با استفاده از روش آلل اسپسیفیک 3 سویه موتان از میان 6 سویه مقاوم فنوتیپی تشخیص داده شدند. همچنین، با کمک این روش 12 سویه غیر متان از میان 17 سویه حساس فنوتیپیتشخیص داده شدند حساسیت این روش50 و ویژگی آن 58/70 درصد بوده است. نتایج تعیین ترادف، اثبات کننده صحت نتایج روش‏های مولکولی مورد استفاده بود.

نتایج تعیین توالی

برای ارزیابی صحت نتایج PCR-RFLP، از روش تعیین توالی به‏عنوان استاندارد طلایی بخش مولکولی استفاده شد. انطباق کامل (100 درصد) نتایج تعیین توالی با PCR-RFLP نشانگر دقت روش مورد استفاده از دیدگاه مولکولی بود. تعیین توالی در ژن ‏rrs، در سویه‏های انتخاب شده به شکل تصادفی، انطباق کامل نتایج PCR-RFLP را با سکونس نشان داد و وجود جهش در کدون‏های 1401,1402 این ژن را در تعدادی از سویه‏های مورد مطالعه اثبات نمود.               

بحث

در این تحقیق، 4 روش مولکولی برای سویه‏هایی که فنوتیپی به روش proportion ‏تعیین شدند اجرا و مقایسه شد. این روش‏ها به گونه ای انتخاب شدند که در استفاده عادی دارای کم‏ترین هزینه بری بوده و در عین حال از سرعت عمل و دقت مناسبی برخوردار باشند.

مقاومت‏هایچندداروییبه علتکمبودامکاناتآزمایشگاهیوتشخیصیمناسبوعدم درمانصحیحدرکشورهایدرحالتوسعه،کهبالاترین میزانآلودگیراداراند،روبهافزایشاست. به علت گسترش روز افزون سل مقاوم به دارو و با توجه به متد درمانی سل، فراهم نمودن روش‏هایی برای تشخیص سریع حساسیت یا مقاومت سویه‏های مایکوباکتریوم توبرکلوزیس به دارو امری ضروری به نظر می‏رسد.

اصولا روش PCR-RFLP بر مبنای شناسایی اختصاصی یک توالی خاص در ژنوم توسط آنزیم‏های مورد استفاده است. در این تحقیق، از دو نوع آنزیم استفاده شد. آنزیم ajii برای تعیین سویه‏های حساس (ترادف وحشی) و آنزیم bstfni برای تعیین حالت موتان (ترادف موتان که در سویه‏های مقاوم یافت می‏شود) با کمک نرم افزار Genetix ‏انتخاب و شرایط واکنش طراحی شدند.

روش آلل اسپسیفیک به گونه ای طراحی شد که تنها قادر به شناسایی ترادف حساس (غیر موتان) باشد. به این ترتیب سویه‏های حساس تشکیل باند داخلی داده اما سویه‏های مقاوم قادر به تشکیل باند نیستند. این روش‏های مولکولی با روش تعییین توالی به عنوان استاندارد طلایی بخش مولکولی و نیز نتایج فنوتیپی به‏عنوان استاندارد طلایی مقاومت مقایسه شدند. نتایج این تحقیق، کارا بودن هر دو روش PCR-RFLP و امکان پذیر بودن استفاده از آن‏ها در روش‏های روتین آزمایشگاهی را نشان داد.

در مطالعه حاضر، آنزیم BstFNI از میان 46 سویه حساس 44 سویه فاقد موتاسیون را تشخیص داد. حساسیت این روش 83/70 و ویژگی آن 65/95 درصد بود.به عبارت بهتر، چنانچه در استفاده روتین، با کمک این روش اگر نمونه ای حساس تشخیص داده شود، می‏توان گفت که بیمار به دارو حساس است. ‏

در این تحقیق، از دیدگاه مقاومت به داروهای تزریقی (آمیکاسین، کانامایسین و کاپرئومایسین) تنوع سویه‏های مورد استفاده ‏درخور توجه بود. به این شکل که تمامی سویه‏های مقاوم به این داروها، بیشتر دارای مقاومت دارویی به سایر دارو‏های خط اول و دوم درمان به سل بودند.

از این میان دو سویه 665X‏و 15T از نظر فنوتیپی مقاوم به کانامایسین ولی حساس به آمیکاسین بودند. ویژگی این سویه‏ها در الگوی ژنتیکی مقاومت دارویی آن‏ها بود. در این نمونه‏ها ‏فقدان موتاسیون در کدون 1401 و 1402 ژن rrs با روش PCR-RFLP اثبات شد و تعیین ترادف ژن این سویه‏ها نیز نبود موتاسیون را اثبات نمود. این مسئله با مطالعات تسوکامورا[2] مطابقت دارد (10).

علاوه بر این، همین دانشمند بیان می‏دارد که سویه‏های جدا شده از بیمارانی که با کانامایسین تحت درمان بوده اند به عنوان سویه‏های مقاوم به کانامایسین و کاپرئومایسین و حساس به ویومایسین تعیین شدند. مقاومت این سویه‏ها به کاپرئومایسین با سطح متفاوتی از مقاومت به کانامایسین همراه بوده است. سویه‏هایی که سطح پایینی از مقاومت به کانامایسین را دارند حساس به کاپرئومایسین بودند (فنوتیپی). این سویه‏ها (کانامایسین مقاوم و کاپرئومایسین حساس) فاقد هرگونه جهش در ژن rrs بوده و سویه‏های مقاوم به کانامایسین و کاپرئومایسین دارای جهش در کدون 1401 و یا 1484 بودند (10).

سویه 116x از نظر فنوتیپی مقاوم به آمیکاسین و کانامایسین و حساس به کاپرئومایسین بوده که رخداد موتاسیون در ژنrrs با روش ‏PCR-RFLPدر این سویه به اثبات رسید. سویه 554x از نظر فنوتیپی مقاوم به سه داروی تزریقی هستند. بررسی آن با آنزیمajii عدم موتاسیون و با آنزیم bstfni وجود موتاسیون در آن را به اثبات رساند.

سویه‏های مقاوم به داروهای تزریقی در این تحقیق، دارای الگوهای متنوع مقاومت دارویی بودند. برای مثال سویه‏های کاملا حساس مانند 3n و 6n، سویه تک مقاومتی به استرپتومایسین مانند 9n، سویه‏های MDR ‏مقاوم به کل دارو‏های خط اول مانند5T ، 1T، 2T، سویه‏های مقاوم به کل داروهای خط اول و دوم درمان که غیر XDR بوده مانند 27n، سویه‏های ‏مقاوم به اکثر داروها 111x و 146x، سویه‏های حساس به داروهای تزریقی نیز دارای تنوعی از تمام حساس
(pansensitive)، سویه‏های MDR ‏حساس به آمیکاسین و کانامایسین و سویه‏های دارای مقاومت به سایر داروها ولی حساس به داروهای تزریقی.در جدول شماره2 تنوع مقاومت به دارو در نمونه‏های مورد مطالعه ارائه شده است.

 در این مطالعه، سویه‏هایی با مقاومت متنوع به آنتی بیوتیک استفاده شدند. برای مثال، سویه‏هایی با مقاومت تک دارویی مثل 9n که مقاوم به استرپتومایسین ‏بودند. 2 دارویی، (18n,24n)که مقاوم به استرپتومایسین و ایزونیازید بوده تا نمونه‏های دارای مقاومت چندگانه به 5 6 ، 7 و 8 دارو (1t، 3t، 26x، 12x، 99x) و دارو‏هایی که به کل دارو‏های خط اول و دوم درمان مقاومند، مانند . (2n,5n)

پریسا طهماسبی و همکاران97سویه مایکوکتریوم توبرکلوزیس را با استفاده از روشPCR-RFLP ‏ارزیابی کردند که از این بین 7 مورد مقاوم به آمیکاسین بوده و 90 مورد حساس به این دارو بودند. این محققین از پرایمر‏های rrs1539 وrrs1096 ‏و آنزیم‏های اندونوکلئاز ‏DdeI،  TaiIاستفاده کرده اند (13 و 17).

در مطالعه حاضر، پرایمر‏های مورد نیاز با استفاده از نرم افزار‏های Mega، Blastو Oligoو آنزیم‏های Ajii و Bstfni برای تعیین جهش در کدون‏های 1401 و 1402 ژن rrs توسط ‏نرم افزارGenetix، طراحی شدند.

آنزیم ‏ajii هر دو کدون 1401 و 1402 را بررسی نموده و برای حالت وحشی طراحی شده است. درحالی‏که آنزیم Bstfni صرفا حالت موتان کدون 1401 را شناسایی می‏کند. این مسئله بر اساس نتایج سایر محققین بوده که اکثر سویه‏های موتان بیشتر درکدون 1401 موتاسیون نشان می‏دهند. بنابراین، با هدف تسهیل روش، سرعت عمل و کاهش خطای پرسنل، روی این کدون تمرکز شد. هم پوشانی نتایج این دو آنزیم، باعث کاهش خطای آزمایش می‏شود.

 

 

a1401g

شکل 6- با استفاده از نرم افزار ‏Genetix سایت‏های برش آنزیمBtrI)AjiI) که برای برش حالت wild (وحشی) و آنزیمACCII)BstFNI‏(که برای برش حالت موتان طراحی شده اند نشان داده شده است. BstUI دارای سایت برش CG^CG)) است و رخداد موتاسیون در 1401 را بررسی می‏کند که با آنزیم(ACCII)BstFNIکه برای برش حالت موتان در این تحقیق طراحی شده است، انطباق دارد.

 

 

آنزیم‏های انتخاب شده با توجه به این‏که تیپ دو هستند (آنزیم‏های تیپ دو دقیقا در ترادف انتخاب شده برش را انجام می‏دهند) بر آنزیم‏های تیپ برتری دارند.

در مطالعه طهماسبی، فراوانیجهش‏هایمربوطبهمقاومتبه آمیکاسیندرکدون 1401 ژن rrs را بیشترازسایرکدون‏ها ‏اثبات نمود. همچنیندر25 نمونه (3/80 درصد) مقاوم به آمیکاسینودرتمامنمونه‏هایحساسبهدارو جهشیمشاهدهنشد. وی اشاره کرده است که در کدون‏های1402 و1484 در ‏نمونه‏هایمقاومجهشی دیده نشد که این با نتایج این تحقیق مطابقت دارد (13).

باتوجه به اختصاصی بودن جایگاه‏های برش پالیندروم 6 نوکلئوتیدی آنزیم AjiI می‏توان گفت که تغییر نوکلئوتیدی در هرکدام از نوکلئوتید‏های 1401 و 1402 به تغییر این سایت اختصاصی برای آنزیم مذکور منجر شده و در نتیجه به طور همزمان می‏توان هر دو نوع موتاسیون را تشخیص داد و ضرورتی به تفکیک رخداد موتاسیون در کدون‏های 1401 و 1402 نیست. بنابراین، آنزیم ‏‏AjiIکه هر دو کدون 1401 و 1402 را بررسی می‏کند، برای استفاده عملیاتی می‏تواند کارا باشد. سوزوکی[3] و سیرگل[4]، نشان دادند که رخداد موتاسیون در هریک از کدون‏های 1401 و 1402 ژن rrs  باعث مقاومت به داروهای تزریقی می‏شود (15 و 19). در این مطالعه جهش در1402 درهیچ یک از نمونه‏ها یافت نشد که با نتایج طهماسبی و سوزوکی،مطابقت دارد (13 و 17).

همانطور که در جدول 2 مشاهده می‏شود، حساسیت و ویژگی به دست آمده از آنزیم bstfni بهتر از آنزیم ajii است. بخصوص ویژگی 65/95 درصد آنزیم bstfni کمک زیادی به حذف موارد منفی کاذب در تشخیص مقاومت آنتی بیوتیکی می‏نماید.

 

 

جدول 2- مقایسه حساسیت و ویژگی آنزیم ajii و ‏Bstfni

آنزیم

تعداد سویه‏های مقاوم فنوتیپی

تعداد سویه‏های مقاوم ژنوتیپی با آنزیم

حساسیت (درصد)

ویژگی (درصد)

BstFNI

24

17

65/95

83/70

AjiI

20

12

62/90

60

 

 

بررسی ترادف نوکلئوتیدی ژن rrsدر سویه‏های کلینیکی مورد مطالعه به کمک نرم افزار Mega4 نشان داد که در برخی از سویه‏های مقاوم، جابجایی نوکلوتید گوانین به جای نوکلوتید آدنین در موقعیت 1401 و نوکلئوتید تیمین به جای نوکلئوتید سیتوزین در جایگاه 1402 دیده می‏شود . نوکلئوتید 1402 تمایل به اتصال به 1484 دارد و جهش در آن سبب عدماتصال 1402 و 1484 با پیوند هیدروزنی می‏شود (12). بر اساس مطالعه موس و همکاران ‏و سوزوکی، بررسی توالی‏های نوکلئوتیدی مشابه در سایر باکتری‏ها مشخص کرد که جهش در کدون 1402 نقش کلیدی در ایجاد مقاومت در سویه‏های مقاوم به کانامایسین ایفا می‏کند. بنابراین، تبدیلc ‏در موقعیت 1402 و g ‏در موقعیت 1484 باعث تضعیف پیوند هیدروژنی می‏شود (17 و 18).

مولکول rrnaS16 که همراه با پروتئین‏های s در تشکیل زیر واحد کوچک ریبوزوم باکتریایی شرکت می‏کند و یکی از اجزای اصلی تشکیل دهنده این ساختار ماکرومولکولی است، در اصل تک رشته ای بوده و ساختارهای ثانویه ای که تشکیل می‏دهد در اثر اتصالات هیدروژنی نوکلئوتید‏های مختلف c,a=t gΞ است. بنابراین، در صورتی که در جایگاه‏های Turn و Loop‏ های تشکیل دهنده ساختار ثانویه این مولکول تغییر ایجاد شود، این مولکول قادر به ایجاد پیوند با پروتئین‏های s نبوده و در نتیجه در ساختار زیر واحد کوچک ریبوزوم ایجاد اختلال می‏شود. و به عدم کارایی مولکول منجر می‏شود (شکل 7).

ساختار ریبو نوکلئوتیدی پروتئین‏های ریبورزوم متشکل از زیرواحد‏های کوچک و بزرگ است و تشکیل زیرواحد‏های کوچک این ساختار ماکرومولکولی، مولکول‏های rrnaS16 و پروتئین‏های کوچک(small protein)نقش دارند که با اینترکشن‏هایی که با هم می‏دهند ساختار سه بعدی و فضایی خاصی برای جایگاه‏های p و a و اتصال mrna‏در موقعیت مناسب و ایجاد ساختار نخستین 30s ‏و در نهایت اتصال به زیرواحد بزرگ ریبوزوم و تشکیل یک ریبونوکلئوتید پروتئین کامل به منظور آغاز فعالیت ترجمه را فراهم می‏کنند.

مطالب یاد شده بیانگر اهمیت وجود میان کنش‏هایی بینmrna ‏های ریبوزومی و زیرواحد‏های پروتئینی ریبوزوم است.

در ایجاد این میان کنش‏ها قطعات ساختار ثانویه rrna و ساختار سه بعدی پروتئین‏ها نقش دارند. تغییر نوکلئوتیدی در 1401به تضعیف پیوندهای هیدروفوب – هیدروفوب بین ساختار پورینی باز موجود در موقعیت 1401 منجر شده و ریشه آمینواسیدهایی با زنجیره جانبی هیدروفوب خواهد شد و در نهایت تشکیل ساختار ریبونوکلئوپروتئینی را به مخاطره می‏اندازد.

تغییر نوکلئوتیدی در 1484 یا 1402می‏تواند به تشکیل پیوند‏های هیدروژنی بین g و ‏c منجر شود و تشکیل ساختار را به نوعی به مخاطره اندازد.

 

 

 

 

 

شکل 7- طرح شماتیک ساختار ثانویه rrna S16 در مایکوباکتریوم توبرکلوزیس و محل کدون 1401. همانگونه که مشاهده می‏شود، هر گونه موتاسیون در نوکلئوتید‏های این کدون باعث تغییر ساختار فضایی مولکول و غیر فعال شدن آن می‏شود.

 

 

در تحقیق حاضر، روش‏های مولکولی ساده و کاربردی برای اجرا به شکل روتین استفاده به عمل آمد. همان گونه که در جدول3 مشاهده می‏شود، سایر محققین بیشتر از روش‏های کشت و تعیین توالی برای تشخیص مقاومت استفاده کرده اند که زمان‏بر بوده و هزینه آزمایش را افزایش می‏دهد.

 

 

جدول 3- مطالعات انجام شده در سال‏های گذشته

مطالعات انجام شده

تعداد نمونه

مقاوم(فنوتیپی)

روش **

ژنوتیپی*

درصد انطباق

حساسیت

( درصد)

ویژگی

( درصد)

(19)

26

mAs-pcr

24

30/92

3/92

2/99

DNA sequencing

23

46/88

8/95

8/98

(13)

181

DNA sequencing

162

50/89

-

-

(20)

150

DNA sequencing

106

66/70

-

-

(22)

136

کشت و mAs-pcr

32

5/23

5/54

100

(23)

48

DNA sequencing

37

77

2/79

100

(21)

26

DNA sequencing

7

92/26

-

-

(12)

78

DNA sequencing

69

46/88

9/85 تا2/94

100

(18)

16

DNA sequencing

11

75/68

_

5/87

(17)

43

 

29

44/67

100

44/67

** روش مولکولی مورد استفاده برای تعیین موتاسیون در کدون‏های مرتبط با مقاومت

* تعداد نمونه‏هایی که با روش مولکولی، مقاومت آن‏ها اثبات شده است.

 

ویرالوادوای[v] در سال 2012، به منظور تعیین عامل مقاومت به دارو‏های خط اول و دوم درمان سل، موتاسیون درکدون‏های (KatG315، rpoB531، GyrA94، rrs1401) را در 450 سویه، با استفاده از روش‏های کشت و mAs-pcr و تعیین توالی بررسی کرد. بررسی نمونه‏ها برای وجود موتاسیون در کدون 1401 ژن rrs با استفاده از روشmAs-pcr، حساسیت و ویژگی به ترتیب برابر3/92 و 2/99 درصدبود. تعیین توالی سویه‏های دارای موتاسیون، به ترتیب حساسیت و ویژگی 8/95 و8/98 درصد را نشان داد (19).

اونسوسگال[vi]، در سال 2010، ‏288 سویه مایکوباکتریوم توبرکلوزیس را با استفاده از روش کشت و mAs-pcr ‏از نظر مقاومت به داروهای خط دوم درمان سل بررسی کرده اند.آن‏ها در این مطالعه حساسیت روش خود را 5/54 و ویژگی آن را 100 درصد مشخص کرده اند (22). درصد انطباق فنوتیپی با ژنوتیپی در روش آلل اسپسیفیک مورد استفاده در تحقیق حاضر، با نتایج این دانشمند مطابقت داشت.

سیرگل در سال 2011، 310 نمونه را از نظر موتاسیون در کدون 1401 با استفاده از روش تعیین توالی بررسی کرد که از این بین، 181 نمونه (58 درصد) دارای موتاسیون بوده و از 129 نمونه دیگر،42 درصد فاقد موتاسیون و6 درصد موتان گزارش شدند. با روشکشت 181 نمونه مقاوم ژنوتیپی، فقط 162 نمونه،از نظر فنوتیپی به آنتی بیوتیک‏های کانامایسین و کاپرئومایسین مقاومت نشان دادند (14).

کانچانآجبانی[vii]در سال 2011، 150 سویه XDR-TB را برای تعیین ‏کدون‏های عامل موتاسیون در ژن‏های rpoB، inhA، katG، gyrA، gyrB، rrsتعیین توالی کرد .که مشخص شد که 71 درصد از سویه‏های مورد بررسی ‏دارای موتاسیون در کدون 1401 ژن rrsبودند.در این بررسی 106 نمونه (71 درصد) دارای موتاسیوندر کدون 1401 ژن rrs و 42 سویه دارای موتاسیون در کدون1484 و 13 نمونه دارای موتاسیون در کدون 1484 ژن rrs و کدون 205 ژن ‏tlyAبودند و3نمونه هم دارای موتاسیون در ژن tlyA به تنهایی بودند (20).

A1401G، برای تشخیص مقاومت به کانامایسین و آمیکاسین 100 درصد اختصاصی بوده، در حالی‏که برای تشخیص حساسیت این عدد 9/85 و 2/94 درصد است (20). نتایج کار این محققین با نتایج تحقیق حاضر در خصوص 1401 مشابهت دارد.

جاووپردیگاوو[viii]  ‏و همکاران، درسال 2005، 26 سویه مایکوباکتریوم توبرکلوزیس را از نظر موتاسیون در ژن‏های rrs، tlyAوgyrA‏‏‏ارزیابی کردند. تحلیل موتاسیونی این ژن‏ها نشان داد که ‏25 سویه، حداقل جهش را در یکی از ژن‏های مورد نظر نشان دادند و فقط 3 سویه به طور همزمان در دو ژن جهش را نشان دادند (21).

سوزوکی[ix] در سال 1998، 71 سویه حساس و 43 سویه مقاوم فنوتیپی را با استفاده از روش PCR-RFLP و تعیین توالی ارزیابی کرد. پس از تعیین توالی این سویه‏ها، از 43 سویه مقاوم فنوتیپی 14 سویه (61/32 درصد) حساس ژنوتیپی و 29 سویه دارای موتاسیون تشخیص داده شد. 26 سویه (5/60 درصد) در 1401، یک سویه (3/2 درصد) در 1402 و 2 سویه (7/4 درصد) در 1484 دارای موتاسیون بودند. در این مطالعه،اشاره شده است که ‏موتاسیون در کدن‏های 1402 و 1484 نیز (علاوه بر 1401) باعث مقاومت به کانامایسین در مایکوباکتریوم توبرکلوزیس می‏شود. در سویه‏هایی که از نظر فنوتیپی مقاوم به کانامایسین بودند، وجود موتاسیون در ژن rrs ‏در 67 درصد از سویه‏های مورد مطالعه یافت شد (17).

سیلکفیورییگل[x] سال 2009، برای بررسی 26 سویه مقاوم به افلوکساسین و 48 سویه مقاوم به کاپرئومایسین و آمیکاسین و 10 سویه (5 سویه مقاوم به آمیکاسین و 5 سویه مقاوم به کاپرئو مایسین) از نظر موتاسیون در ژن‏های (tlyA، rrs، gyrA، gyrB) از روش تعیین توالی استفاده کرده است (49 سویه حساس به افلوکساسین و 39 سویه حساس کاپرئومایسین و آمیکاسین هم به عنوان شاهد در نظر گرفته شدند).34 سویه از 48 سویه مقاوم به کاپرئومایسین و آمیکاسین دارای موتاسیون در کدون 1401 ژن rrs بودند. در یکی از سویه‏های مقاوم به کاپرئومایسین جهش در کدون 1402 مشاهده شد. 10 سویه هم فاقد هر گونه جهش در ژن‏های tlyA و rrs بودند، که 5 سویه مربوط به سویه‏هایی که تنها به آمیکاسین مقاوم بودند مشاهده شد. 3 سویه هم دارای جهش در ژن  tlyA بودند. در بررسی 39 سویه حساس به این دو دارو هیچ جهشی در ژن‏های tlyA، rrsمشاهده نشد. حساسیت و ویژگی روش آن‏ها برای تشخیص مقاومت به داروهای تزریقی خط دوم 2/79 و ویژگی آن 100 درصد بوده است. در پایان، اشاره داشتند که بیشترین جهش در ژن rrs، به نوکلئوتید 1401 اطلاق شده است (23).

با توجه به نتایج محققین یاد شده و نیز طهماسبی (13) نتایج تحقیق حاضر با بررسی‏های این محققین در خصوص ارتباط مقاومت فنوتیپی بیشتر به موتاسیون در 1401 مطابقت دارد (13).

در مطالعه آلانگادن[xi] و همکاران در سال 1998، بیان شده است که موتاسیون در کدون 1401 ژن rrs باعث سطح بالایی از مقاومت به کانامایسین وآمیکاسین در مایکوباکتریوم توبرکلوزیس را سبب می‏شود. در این مطالعه جابجایی a به g در 13 سویه مورد مطالعه مشاهده شد که نیمی از این تعداد مقاوم به کاپرئومایسین نیز بودند (16).

همان گونه که از جدول 3 قابل استنباط است، انطباق کاملی بین نتایج روش‏های مولکولی سریع با نتایج آنتی بیوگرام به روش کشت وجود ندارد. این مسئله حتی هنگام استفاده از تعیین توالی نیز مشاهده می‏شود. بنابراینحضور مقاومت بدون تغییرات در ژن rrs نشان دهنده این است که اصولا روش‏های مولکولی درصد انطباق کاملی با روش‏های فنوتیپی ندارند که این مسئله به علت دخالت احتمالی مکانیسم‏های دیگراز جمله مقاومت ذاتی مایکوباکتریوم مرتبط با دیواره و یا ژن‏های دیگر (غیر از ژن rrs) است (19).

 

نتیجه گیری

نتایجاینتحقیق بر مبنای مقایسه سه روش مولکولی و نیز تعیین توالی ‏نشانمیدهد که روش PCR-RFLP طراحی شده با آنزیم BstFNI، برای اجرا در تشخیص روتین مقاومت می‏تواند به عنوان یک روش سریع و روتین در تشخیص مقاومت مایکوباکتریوم توبرکلوزیس به داروهای تزریقی خط دوم درمان سل در آزمایشگاه‏های تشخیص طبی استفاده شود .

تشخیص سریع و در دسترس سویه‏های مقاوم باکتری، درمان به موقع بیماران مبتلا، جلوگیری از افزایش هزینه بیماران مسلول،کمک به حذف سریع‏تر یک عامل انتشار بیماری به دنبال تشخیص به موقع یک بیماری مقاوم به دارو و درمان آن که از دیدگاه اپیدیمیولوژیک بسیار حائز اهمیت می‏باشد، از نتایج این تحقیق به شمار می‏رود.

تشکر و قدردانی

اینپژوهشبخشیازطرحتحقیقاتیمصوب دانشگاهعلومپزشکیاراکاست.بنابراین،بدین‏وسیلهاز معاونتپژوهشیدانشگاهعلومپزشکیاراکتشکرو قدردانیمی‏شود. همچنینازمرکز تحقیقاتسل و عفونی کودکاندانشگاهعلومپزشکیاراکبه علتپشتیبانیتجهیزاتو امکاناتو ازکلیههمکارانیکهمارادراینپژوهشیارینمودهاندصمیمانهتشکرو قدردانیمی‏شود.

 

 

 

 



[1]. Sequencing

[2]. Tsukamura

[3]. Suzuki

[4]. Sirgel

[v]. Viral Vadwai

[vi]. J. Evans and H Segal

[vii]. Kanchan Ajbani

[viii]. ‏Joa˜O Perdiga˜O

[ix]. Suzuki

[x]. Silke Feuerriegel

[xi]. Alangaden

References

(1) Fair E, Hopewell P, Pai M, international standards for tuberculosis care :revisiting the cornerstones oftuberculosis care and control. expert rer anti infect ther 2007;5 (1): 5– 61.

(2) World Health Organization. 2007: Tuberculosis facts. Availableat: http://www.WHO.int/tb/publications/2007/factsheet_2007.pdf . Accessed january 14, 2008

(3) Harries A, Dye C, Tuberculosis .Ann Trop Med Parasitol 2006; 100(5-6):415-31.

(4) Pineda-Garcia L, Ferrera A, Hoffner Se, DNA Fingerprinting Of Mycobacterium Tuberculosis Strains From Patients With Pulmonary Tuberculosis In Honduras. J Clin Microbiol 1997;35(9):2393-7.

(5) Caminero J, Pena M, Campos-Herrero M, Rodríguez J, García I, Cabrera P, et al. Epidemiological Evidence Of The Spread Of A Mycobacterium Tuberculosis Strain Of The Beijing Genotype On Gran Canaria Island. Am J Respir Crit Care Med 2001 164(1):1165-70.

(6) Calver A, Falmer A, Murray M, Strauss O, Streicher E, Hanekom M, et, al. Emergence of increased resistance and extensively drug-resistant tuberculosis despite treatment adherence, South africa. emerg infect dis 2010; 16: 264–71.

(7) Keshavjee S, Gelmanova I, Farmer P, Mishustin S, Strelis A, Andreev Y, et al. Treatment of extensively drug-resistant tuberculosis in Tomsk, Russia: a retrospective cohort study. The Lancet2008; 372(9647):1403-9.

(8) Hopewell P, Pai M, Maher D, Uplekar M, Raviglione M. International standards for tuberculosis care. Lancet Infect Dis. 2006 ;6(11):710-25.

(9) Magnet S, Blanchard J. Molecular insights into aminoglycoside action and resistance, Chem Rev 2005; 105(2):477-98.

(10)Tsukamura, M. Cross-Resistance Relationships Between Capreomycin, Kanamycin, And Viomycin Resistances In Tubercle Bacilli From Patients. Am Rev Respir Dis 1969; 99(5):780-2.

 

(11) Trnka L, Smith D. Proteosynthetic activity of isolated ribosomes of Mycobacteria and its alteration by rifampicin and related tuberculostatic drugs. Antibiot Chemother 1970; 16:369-79.

(12) Jugheli L, Bzekalava N, De Rijk P, Fissette K, Portaels F, Rigouts L. High Level Of Cross-Resistance Between Kanamycin, Amikacin, And Capreomycin Among Mycobacterium Tuberculosis Isolates From Georgia And A Close Relation With Mutations In The Rrs Gene. Antimicrob Agents Chemother 2009;

(13)Tahmasebi P, Sheikolslami F, Farnia P, Sadeghizadeh M, Ramazanzadeh R, Kazempoor M, et al. Detection of amikacin-resistance among MDR strains of Mycobacterium Tuberculosis by using PCR-RFLP Method. j ardabil univ med Sci 2011; 11(4): 345-53.

(14) Sirgel F. Tait M. Warren R. Streicher E. Böttger E. Van Helden P. et al. Mutations In The Rrs A1401g Gene And Phenotypic Resistance To Amikacin And Capreomycin In Mycobacterium Tuberculosis. Microb Drug Resist. 2012; 18(2):193-7.

(15) N Honoré, G Marchal, S T Cole Novel Mutation In 16s Rrna Associated With Streptomycin Dependence In Mycobacterium Tuberculosis. Antimicrob Agents Chemother 1995; 39(3): 769–770.

(16) Alangaden G, Kreiswirth B, Aouad A, Khetarpal M, Igno F, Moghazeh S, et al. Mechanism Of Resistance To Amikacin And Kanamycin In Mycobacterium Tuberculosis. Antimicrob Agents Chemother 1998;42(5):1295-7.

(17) Suzuki Y, Katsukawa C, Tamaru A, Abe C, Makino M, Mizuguchi Y, et al. Detection Of Kanamycin-Resistant Mycobacterium Tuberculosis By Identifying Mutations In The 16s Rrna Gene. J Clin Microbiol 1998; 36(5):1220-5.

(18) Maus C, Plikaytis B, Shinnick T. Mutation of tlyA confers capreomycin resistance in Mycobacterium tuberculosis, antimicrob agents chemother 2005; 49: 571–577.

(19) Vadwai V, Shetty A, Rodrigues C, Multiplex Allele Specific Pcr For Rapid Detection Of Extensively Drug Resistant