ردیابی مولکولی و بیوشیمیایی استافیلوکوکوس اورئوس در موارد ناباروری و سقط گاو در شهرکرد

نویسندگان

1 کارشناس ارشد باکتری شناسی، دانشگاه شهرکرد، ایران

2 استادیار بیماری‏های تولیدمثل، دانشگاه آزاد اسلامی واحد شهرکرد، ایران

3 دکتری دامپزشکی، دانشگاه شهرکرد، ایران

4 دانشجوی دکتری دامپزشکی، دانشگاه شهرکرد، ایران

5 دانشیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران

6 دانشجوی دکتری تخصصی بیماری‏های داخلی دام بزرگ دانشگاه شهرکرد، ایران

چکیده

مقدمه: ناباروری و سقط جنین می‏توانند به زیان‏های جدی اقتصادی منجر شوند. استافیلوکوکوس اورئوس می‏تواند ناباروری و سقط جنین ایجاد نماید. با توجه به اهمیت آنچه ذکر شد، مطالعه حاضر برای ردیابی استافیلوکوکوس اورئوس در موارد ناباروری و سقط گاو در شهرکرد انجام شد.
مواد و روش‏‏ها: ترشحات واژنی 90 گاو مبتلا به آندومتریت و 26 گاو سقط کرده برای ردیابی استافیلوکوکوس اورئوس بررسی شدند. نمونه‏ها روی محیط کشت مانیتول سالت آگار کشت داده شدند و در دمای 37 درجه سانتی‏گراد به مدت 48 ساعت انکوبه شدند. کلونی‏های مشکوک برای ردیابی استافیلوکوکوس اورئوس به وسیله آزمون‏های بیوشیمیایی و واکنش زنجیره ای پلی مراز (PCR) ارزیابی شدند.
نتایج: استافیلوکوکوس اورئوس از 5/5 درصد (5 از 90) از موارد آندومتریت گاو و از 7/7 درصد (2 از 26) از موارد سقط جداسازی شد.
بحث و نتیجهگیری: این مطالعه نشان داد که استافیلوکوکوس اورئوس ممکن است در ایجاد آندومتریت و سقط جنین در گاو در شهرکرد نقش داشته باشد اما نمی‏توان استافیلوکوکوس اورئوس را عامل اصلی ایجاد آندومتریت و سقط گاو در این منطقه تلقی نمود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Molecular and biochemical detection of Staphylococcus aureus from bovine infertility and abortion in Shahrekord

نویسندگان [English]

  • Sara Barati 1
  • Taghi Taktaz Hafshejani 2
  • Amir Momeni 3
  • Samaneh Mehrabiyan 4
  • Hassan Momtaz 5
  • Hamid Esmaili Najafabadi 4
  • AhmadReza Safian 6
1 M.Sc. of Microbiology, University of Shahrekord, Iran
2 Assistant Professor of Veterinary Reproduction and Obstetrics, Islamic Azad University
3 DVM, University of Shahrekord, Iran
4 DVM Student, University of Shahrekord, Iran
5 Associate Professor of Microbiology, Islamic Azad University, Shahrekord, Iran
6 Ph.D Student of Large Animal Internal Medicine, University of Shahrekord, Iran
چکیده [English]

Introduction: Infertility and abortion can lead to major economic losses. Staphylococcus aureuscan cause infertility and abortion. Considering the importance of what was mentioned, present study was conducted to detect S. aureusin bovine infertility and abortion from Shahrekord, Iran.
Materials and methods: Vaginal discharge from 90 cows with endometritis and 26 aborted cows were investigated to detec S. aureus. Samples were streaked on to Mannitol salt agar plates and incubated at 37°C for 48 hours. Suspected colonies were evaluated to detect S. aureusby biochemical and polymerase chain reaction (PCR) methods.
Results: S. aureus was isolated from %5.5 (5 out of 90) of bovine endometritis and %7.7 (2 out of 26) of aborted cows.
Discussion and conclusion: The study showed that S. aureusmight play a role in bovine infertility and abortion in Shahrekord, but S. aureuscould not be considered as the major cause of bovine infertility and abortion in the region.

کلیدواژه‌ها [English]

  • S. aureus
  • Endometritis
  • Abortion

 مقدمه

آندومتریت، عفونت رحم بدون علائم سیستمیک است که با حضور ترشحات موکوسی چرکی یا چرکی در رحم تظاهر می‏یابد. رخداد این بیماری بالاست و پس از زایمان به وسیله عفونت واحد و یا به همراه عفونت با سایر باکتری‏ها، ویروس‏ها، قارچ‏ها، مایکوپلاسما و... ایجاد می‏شود (1- 3).

این بیماری به عنوان یک عامل خطر در ایجاد کیست تخمدانی، آنستروس و سایر مشکلات تناسلی مطرح است و با اثر ‏گذاری بر تولید شیر، به زیان‏های جدی اقتصادی منجر می‏شود (4 و 5). این بیماری باعث افزایش تعداد تلقیح به آبستنی منجر و در نتیجه باعث طولانی شدن فاصله بین زایمان و کاهش میزان گوساله زایی می‏شوند و در نهایت این اختلالات رحمی به کاهش عملکرد تناسلی منجر می‏شوند. به طور معمول 15 تا 20 درصد گاوها در 4 تا 6 هفته پس از زایمان دچار آندومتریت بالینی و 30 تا 35 درصد گاوها در 4 هفته پس از زایمان دچار آندومتریت تحت بالینی می‏شوند.

روش‏های متعددی برای درمان آندومتریت پس از زایمان وجود دارد که شامل تزریق داخل رحمی آنتی‏بیوتیک‏ها یا مواد سپتیک، تجویز سیستمیک آنتی‏بیوتیک‏ها و هورمون درمانی (استروژن و پروستاگلندین) است.

بیشتر مطالعات نشان می‏دهند که باکتری‏های بیماری‏زا نقش مهمی در فرایند رخداد و تشدید آندومتریت بازی می‏کنند (6 و 7) که از میان آن‏ها استافیلوکوکوس اورئوس، اشریشیا کلی و باسیلوس سرئوس معمول‏ترین باکتری‏های بیماری‏زا هستند (8).

سقط جنین نیز می‏تواند باعث خسارات جدی اقتصادی و بهداشتی شود. عوامل زیادی در ایجاد سقط جنین می‏توانند نقش داشته باشند. یکی از مهم‏ترین عوامل ایجاد کننده و تاثیرگذار در سقط جنین، عوامل میکروبی هستند. عوامل بیماری‌زای باکتریایی از قبیل استافیلوکوکوس اورئوس می‏توانند جنین را آلوده کنند و به سقط‏های تک‌گیر در گاو منجر شوند (9 و 10)

گزارشات متعددی از نقاط مختلف دنیا در زمینه جداسازی استافیلوکوکوس اورئوس از موارد آندومتریت، متریت و سقط جنین در گاو وجود دارد (9- 19).

برای شناسایی و جداسازی استافیلوکوکوس اورئوس، معمولا نمونه‏ها را روی محیط مانیتول سالت آگار کشت می‏دهند. کلونی‏های زرد رنگ (از نظر تخمیر مانیتول مثبت)، با آزمایش‏های رنگ آمیزی گرم، کاتالاز، کوآگولاز و آزمایش DNAse آزمایش می‏شوند و اگر نتایج آن‏ها نیز مثبت بود، جدایه مورد نظر، استافیلوکوکوس اورئوس تشخیص داده می‏شود (20). اما به تازگی گزارشاتی در مورد وجود استافیلوکوکوس اورئوس‏های مانیتول منفی منتشر شده است (21). هر چند احتمال رخداد و شیوع استافیلوکوکوس اورئوس‏های مانیتول منفی، بسیار پایین است و وضعیت شیوع آن‏ها نامعلوم و مجهول است (21) اما احتمال حضور آن‌ها در نمونه‏های کلینیکی و غیر کلینیکی وجود دارد. همچنین رائو[1] و همکاران استافیلوکوکوس اورئوس‏هایی را یافتند که  DNAse منفی بودند و علتی را نیز برای این نتیجه نیافتند (22).

آزمایش‏های مولکولی برای تشخیص دقیق بسیاری از میکروارگانیسم‏ها استفاده شده اند. همچنین آزمایش‏های مولکولی در مقایسه با آزمایش‏های بیوشیمیایی، خطای کمتری دارند. ژن Femb یک ژن کروموزمی است و برای شناسایی اختصاصی استافیلوکوکوس اورئوس با روش PCR به عنوان یک روش اختصاصی، دقیق و حساس بکار گرفته شده است (23).

آزمایش PCR، ژنوم باکتری‏های زنده (فعال) و مرده (غیر فعال) را تکثیر می‏کند و تفاوتی بین باکتری‏های زنده و مرده قایل نمی‏شود. زمانی‌که می‏خواهیم عوامل بیماری‌زای فعال در یک نمونه‌ی کلینیکی را بررسی کنیم، بهتر است در ابتدا روی محیط کشت تکثیر کنیم و سپس از PCR استفاده کنیم و روی نمونه‏ها PCR مستقیم انجام ندهیم.

با توجه به این‏که بیماری‏های تناسلی و سقط جنین می‏توانند به زیان‏های جدی اقتصادی منجر شوند و این‏که اطلاعات چندانی در مورد وضعیت آلودگی به استافیلوکوکوس اورئوس در بیماری‏های تناسلی و سقط جنین گاو در کشور در دست نیست و نقش احتمالی استافیلوکوکوس اورئوس در ایجاد بیماری‏های تناسلی و سقط جنین در گاو در این منطقه در ‏هاله ای از ابهام باقی مانده است، در این مطالعه به ردیابی مولکولی و بیوشیمیایی استافیلوکوکوس اورئوس در موارد ناباروری و سقط جنین در گاوهای شهرکرد، پرداخته شد.

 

مواد و روش‏ها

نمونه گیری

در این مطالعه که از زمستان سال 1389 تا زمستان سال 1390 انجام شد، به وسیله سواب استریل از ترشحات واژنی 90 گاو مبتلا به آندومتریت و 26 گاو سقط کرده در منطقه شهرکرد، نمونه گیری انجام شد. سواب‌ها به طور مستقیم درون محیط آبگوشت غنی‏کننده استریل انداخته شدند و به آزمایشگاه منتقل و به مدت 24 ساعت در دمای 37 درجه سانتی‏گراد انکوبه شدند.

کشت و آزمایش‏های بیوشیمیایی

در آزمایشگاه نمونه‏ها روی محیط مانیتول سالت آگار (مرک، ساخت آلمان) کشت داده و به مدت 48 ساعت در دمای 37 درجه سانتی‏گراد انکوبه شدند. کلونی‏های مشکوک که از نظر تخمیر مانیتول مثبت بودند، تحت آزمایش‏های رنگ آمیزی گرم، کاتالاز، کوآگولاز و آزمایش DNAse (کلونی‌های مشکوک را روی محیط DNase Agar کشت داده و برای مدت 24 ساعت در دمای 37 درجه سانتی‌گراد قرار داده و سپس روی پلیت‌ها اسیدکلریدریک یک نرمال ریخته و کلونی‌های دارای ‏هاله شفاف مثبت تلقی شدند) آزمایش شدند (20). نمونه‏های مشکوک برای تشخیص دقیق‏تر به وسیله PCR نیز آزمایش شدند.

PCR

برای تایید استافیلوکوکوس اورئوس به وسیله PCR از پرایمرهای درج شده در جدول 1 استفاده شد (23). واکنش PCR با استفاده از مواد تهیه شده از شرکت سیناژن در حجم 25 میکرولیتر (5/2 میکرولیتر بافر10XPCR، 5/1 میکرولیتر MgCl2 50 میلی‏مولار، 7/0 میکرولیترdNTP ‏10 میلی‏مولار، 5/1 واحد آنزیم Taq پلی مراز، 5/0 میکرولیتر با غلظت 10 میکرومولار از هر پرایمر، 1 میکرولیتر DNA الگو) انجام شد. برنامه دمایی مورد استفاده به ترتیب واسرشت ابتدایی در 94 درجه سانتی‏گراد به مدت 5 دقیقه و 40 سیکل از قرار 94 درجه به مدت 30 ثانیه، 64 درجه به مدت 30 ثانیه، 72 درجه به مدت 45 ثانیه و گسترش نهایی به مدت 5 دقیقه در دستگاه ترموسایکلر (بایورد، ساخت آمریکا) انجام شد. در پایان محصولات PCR روی ژل آگاروز 5/1 درصد الکتروفورز شد.

 

 

جدول 1- جدول مشخصات پرایمرهای مورد استفاده

اندازه محصول

منبع

توالی پرایمرها

نام ژن هدف

651 bp

(23)

F: TTACAGAGTTAACTGTTACC

R: ATACAAATCCAGCACGCTCT

Femb

 

 

نتایج

در نتایج آزمایش‏های بیوشیمیایی برای کلونی‏هایی که از نظر ظاهری مشکوک به استافیلوکوکوس اورئوس بودند، از موارد آندومتریت 5/5 درصد (5 نمونه از 90 نمونه) آلوده به استافیلوکوکوس اورئوس و از موارد سقط 7/7 درصد (2 نمونه از 26 نمونه) آلوده به استافیلوکوکوس اورئوس بود. همچنین برای ارزیابی دقیق‏تر که از آزمون PCR برای جستجوی استافیلوکوکوس اورئوس استفاده شد، نتایج با آزمایش‏های بیوشیمیایی مطابقت داشت (شکل 1).

 

 

 

شکل 1- تصویر الکتروفورز ژل آگاروز استافیلوکوکوس اورئوس. M: نشانگر100 جفت بازی پلاس، NC: کنترل منفی، PC: کنترل مثبت استافیلوکوکوس اورئوس ATCC25923،PTCC1431(651 جفت باز)، 1 تا 7: نمونه‏های مثبت شده استافیلوکوکوس اورئوس

 

 

 

بحث و نتیجه گیری

با در نظر گرفتن اینکه بیماری‏های تناسلی و سقط جنین می‏توانند زیان‏های چشمگیر اقتصادی ایجاد نمایند، اجرای مطالعات تعیین کننده میزان آلودگی به باکتری‏های بیماری زا در پروسه رخداد و تشدید آندومتریت و سقط، می‌توانند نقش مهمی در شناسایی وضعیت آلودگی به عوامل بیماری زای مختلف و تعیین استراتژی مناسب برای درمان و مقابله با آندومتریت و سقط بازی کنند.

در مورد سقط جنین در گاو مطالعاتی در زمینه بررسی عوامل بیماری زای مختلف از قبیل بروسلا، لپتوسپیرا، کمپیلوباکتر و کلامیدیا در کشور انجام شده است (24- 27). اما متاسفانه اطلاعات چندانی در مورد وضعیت آلودگی به استافیلوکوکوس اورئوس در بیماری‏های تناسلی و سقط گاو در کشور در دست نیست و نقش احتمالی استافیلوکوکوس اورئوس در ایجاد بیماری‏های تناسلی و سقط در گاو در این منطقه در‏ هاله ای از ابهام باقی مانده است.

مطالعاتی که روی وضعیت آلودگی به استافیلوکوکوس اورئوس در موارد بیماری‏های تناسلی انجام شده شیوع متفاوتی از مقادیر پایین تا مقادیر بالا را در گاوهای مبتلا به عفونت دستگاه تناسلی در مکان‏های مختلف نشان می‏دهد. در مطالعه باتابیال[ii] و همکاران 152 گاو مبتلا به عفونت دستگاه تناسلی بررسی شدند. 8 نمونه از 152 نمونه (33/5 درصد) به عنوان استافیلوکوکوس کوآگولاز مثبت تشخیص داده شدند (11). در مطالعه ای که در چین انجام شد (11- 20) استافیلوکوکوس اورئوس از 35/11 درصد از گاوهای مبتلا به آندومتریت جداسازی شد (12). در یک بررسی که در عراق انجام شد استافیلوکوکوس اورئوس از 13 درصد از بوفالوهای مبتلا به متریت جداسازی شد (13). در مطالعه دیگری که توسط عزاوی[iii] و همکاران انجام شده است شیوع استافیلوکوکوس اورئوس بین بوفالوهای عراق که مبتلا به آندومتریت بودند به میزان 15/15 درصد گزارش شده است (14). در مطالعه زهید[iv] درپاکستانرویگاوهاییمبتلا به آندومتریت، آلودگی به استافیلوکوکوس اورئوس 6/23 درصد اعلامشد (15). در مطالعه میشرا[v] و همکاران، از واژن تعدادی گاو و بوفالو، نمونه گیری انجام شد که میزان آلودگی به استافیلوکوکوس اورئوس 3/33 درصد اعلام شد (16).

پژوهش‏های به عمل آمده روی وضعیت آلودگی به استافیلوکوکوس اورئوس در موارد سقط گاو نیز شیوع متفاوتی را در جاهای مختلف نشان می‏دهد. در پژوهشی که در کالیفرنیای ایلات متحده انجام شد، از میان 76 مورد سقطی که عوامل باکتریایی در ایجاد آن نقش داشتند از 2 مورد استافیلوکوکوس جداسازی شد (9). در مطالعه جامالودین[vi] و همکاران روی سقط در گاوهای شیری از میان 107 مورد سقط با علت باکتریایی، استافیلوکوکوس در 2 مورد شناسایی شد (17). در مطالعه ای روی گله گاوهای شیری دانمارکی از میان 17 مورد سقط با علت باکتریایی، استافیلوکوکوس اورئوس در 2 مورد یافت شد (18). در مطالعه کوربیلینی[vii] و همکاران نیز استافیلوکوکوس اورئوس از سقط در گاو جداسازی شد (19).

این مطالعه نشان می‏دهد که گاوهای مبتلا به آندومتریت و سقط در این منطقه می‏توانند به استافیلوکوکوس اورئوس آلوده شوند. در بسیاری از مطالعات انجام شده در سایر نقاط دنیا، استافیلوکوکوس اورئوس با شیوع متفاوت در موارد آندومتریت و سقط یافت شده است. با توجه به نتایج حاصل از این مطالعه به نظر می‏رسد که نمی‏توان استافیلوکوکوس اورئوس را از عوامل اصلی ایجاد آندومتریت و سقط گاو در این منطقه تلقی نمود و ممکن است عوامل بیماری زای دیگری نیز در ابتلای به آندومتریت و سقط گاو در این منطقه تاثیرگذار باشند که در این مطالعه بررسی نشده است. بنابراین، بررسی‏های بیشتر در این زمینه توصیه می‏شود.



[1]. Rao

[ii]. Batabyal

[iii]. Azawi

[iv]. Zahid

[v]. Mishra

[vi]. Jamaluddin ‏

[vii]. Corbellini

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

References

(1) Coleman DA, Thayne WV, Dailey RA. Factors affecting reproductive performance of dairy cows. J Dairy Sci 1985; 68(7):1793-803.

(2) Dubuc J, Duffield TF, Leslie KE, Walton JS, Leblanc SJ. Effects of postpartum uterine diseases on milk production and culling in dairy cows. J Dairy Sci 2011; 94(3):1339-46.

(3) Griffin JF, Hartigan PJ, Nunn WR. Nonspecific uterine infection and bovine fertility. I. Infection patterns and endometritis during the first seven weeks post-partum. Theriogenol 1974; 1(3):91-106.

(4) Bicalho RC, Machado VS, Bicalho ML, Gilbert RO, Teixeira AG, Caixeta LS, et al. Molecular and epidemiological characterization of bovine intrauterine Escherichia coli. J Dairy Sci 2010; 93(12):5818-30.

(5) Ruder CA, Sasser RG, Williams RJ, Ely JK, Bull RC, Butler JE. Uterine infection in the postpartum cow. II. Possible synergistic effect of Fusobacterium necrophorum and Corynebacterium pyogenes. Theriogenol 1981; 15:573–80.

(6) Farin PW, Ball L, Olson JD, Mortimer RG, Jones RL, Adney WS, et al. Effect of Actinomyces pyogenes and gram-negative anaerobic bacteria on the development of bovine pyometra. Theriogenol 1989; 31(5):979-89.

(7) Li L, Yang HJ, Liu DC, He HB, Wang CF, Zhong JF, et al. Biofilm formation and analysis of associated genes involved in Staphylococcus isolates from bovine mastitis. Sci Agr Sinica 2011; 44: 160-6.

(8) Xu YJ, Su Q, Huang YX. Examination of pathogenic bacteria of cow’s endometritis in Guangzhou. Chinese J Animal Poultry Infect Dis 1998; 20: 129-31.

(9) Anderson ML, Blanchard PC, Barr BC, Hoffman RL. A survey of causes of bovine abortion occurring in the San Joaquin Valley, California. J Vet Diagn Investig 1990; 2(4):283-7.

(10) Kirkbride CA. Diagnostic survey of livestock abortion. Ames, Iowa, United States; Iowa State University Press, 1990: 17–9

(11) Batabyal K, Das B, Singh B. Identification and antibiogram of pathogenic Staphylococci isolated from bovine genital infections. J Interacademicia 2009; 13(1): 99-101

(12) Dong-bo S, Rui W, Xian-jing H, Shuang W, Yun-cheng L, Xu H, et al. Development of a multiplex PCR for diagnosis of Staphylococcus aureus, Escherichia coli and Bacillus cereus from cows with endometritis. Agr Sci China 2011, 10(10): 1624-1629.

(13) Azawi OI, Omran SN, Hadad JJ. Clinical, bacteriological, and histopathological study of toxic puerperal metritis in Iraqi buffalo. J Dairy Sci 2007; 90(10): 4654-60.

(14) Azawi OI, Omran SN, Hadad JJ. A study of endometritis causing repeat breeding of cycling iraqi buffalo cows. Reprod Domest Anim2008; 43(6):735-43.

(15) Zahid A. Culture and sensitivity of bacterial growth from exotic cows suffering from endometritis under Pakistani conditions. Pak Vet J 2004; 24(2): 107-108.

(16) Mishra VK, Arora S, Bist B, Kumar S. Isolation of bacteria from the genital tract of cattle and buffaloes of Gorakhpur district and their antibiograms. Indian J Vet Med 2005; 25(1):43.

(17) Jamaluddin AA, Case JT, Hird DW, Blanchard PC, Peauroi JR, Anderson ML. Dairy cattle abortion in California: evaluation of diagnostic laboratory data. J Vet Diagn Investig 1996; 8(2):210-8.

(18) Agerholm JS, Willadsen CM, Nielsen TK, Giese SB, Holm E, Jensen L, et al. Diagnostic studies of abortion in Danish dairy herds. Zentralbl Vet Med A 1997; 44(9-10): 551-8.

(19) Corbellini LG, Pescador CA, Frantz FJ, Cardoso M, Driemeier D. Staphylococcus spp. abortion: skin lesions caused by Staphylococcus aureus infection in an aborted bovine-fetus. Vet Res Commun 2006; 30(7):717-21.

(20) Sharifi M. Application, Interpretation and principles of biochemical tests in medical microbiology. Tabriz; Ahrar Company 2000: 257-503.

(21) Shittu A, Lin J, Morrison D. Molecular identification and characterization of mannitol-negative methicillin-resistant Staphylococcus aureus. Diagn Microbiol Infect Dis 2007; 57(1):93-5.

(22) Rao JG, Qamruddin AO, Hassan IA, Burnie JP, Ganner M. Cluster of clinical isolates of epidemic methicillin-resistant Staphylococcus aureus (EMRSA) with a negative deoxyribonuclease (DNase) test-implications for laboratory diagnosis and infection control. J Hosp Infect. 2002; 51(3):238-9.

(23) Pérez-Roth E, Claverie-Martín F, Villar J, Méndez-Alvarez S. Multiplex PCR for simultaneous identification of Staphylococcus aureus and detection of methicillin and mupirocin resistance. J Clin Microbiol 2001; 39(11):4037-41.

(24) Arshi A, Doosti A, Sharifzadeh A. PCR assay for detection of abortion rate caused by Chlamydia psittaci in Iranian cattle. Bangkok, Thailand; Int Conf Adv Biotechnol Pharm Sci, December 2011.

(25) Hamali H, Nofouzi K, Jafari R. A molecular (PCR) survey on abortions caused by Campylobacter spp. in the dairy cattle of Tabriz-Iran. Online J Anim Feed Res 2011; 1(5): 205-208

(26) Moshkelani S, Javaheri-Koupaei M, Rabiee S, Moazeni M. Detection of Brucella spp. and Leptospira spp. by multiplex polymerase chain reaction (PCR) from aborted bovine, ovine and caprine fetuses in Iran. Afr J Microbiol Res 2011; 5(26): 4627-30

(27) SharifZadeh A, Doosti A, Jafarian Dehkordi M, Rafiee A. A multiplex PCR for the diagnosis of important cause of abortion. J Modern Vet Res 2009; 2(1): 19-26