جستجوی مولکولی لیستریا مونوسیتوژنز و لیستریا ایوانوای در کبوترهای شهرستان یزد

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشیار بیماری‏های طیور، دانشگاه شهرکرد ، شهرکرد، ایران

2 دانشجوی دکتری دامپزشکی، دانشگاه شهرکرد ، ایران

3 دانشیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، شهرکرد، ایران

4 دانشجوی دکتری دامپزشکی، دانشگاه شهرکرد، شهرکرد ، ایران

5 دانشجوی دکتری دامپزشکی، دانشگاه شهرکرد ، ایران،

چکیده

مقدمه: پرندگان می‏توانند عوامل بیماری‏زا‏ی انسانی، از قبیل لیستریا مونوسیتوژنز و لیستریا ایوانوای را در خود جای دهند و به انسان منتقل کنند. با توجه به علاقه بسیاری از مردم در نگهداری ‏از کبوتر، در این مطالعه به ارزیابی آلودگی به لیستریا مونوسیتوژنز و لیستریا ایوانوای در مدفوع کبوترهای یزد پرداخته شد. مواد و روش‏ها‏: تعداد 150 نمونه مدفوع از کبوتر از مناطق مختلف شهرستان یزد به وسیله سوآب استریل جمع آوری شد. سوآب‏ها‏ مستقیما درون محیط آبگوشت غنی کننده لیستریا قرار داده شدند. یک میلی‏لیتر‏ از محیط‏ها‏ی کشت مغذی اولیه به 9 میلی‏لیتر آبگوشت فریزر اضافه شد. پس از غنی‏سازی، نمونه‏ها‏ بر روی محیط کشت پالکام آگار کشت داده شدند. سپس نمونه‏ها‏ با استفاده از روش PCR برای بررسی وجود لیستریا مونوسیتوژنز و لیستریا ایوانوای ارزیابی شدند. نتایج: گرچه شیوع جنس لیستریا دو درصد (3 از 150) بود، اما در هیچ کدام از نمونه‏ها‏ لیستریا مونوسیتوژنز و لیستریا ایوانوای یافت نشد. بحث و نتیجه گیری: منبع گونه‏ها‏ی لیستریا در پرندگان، غذای مورد استفاده و محیط زندگی آنهاست. احتمالاً به دلیل این‏که سطح بهداشتی، وضعیت تغذیه‏ای و محیط زندگی در کبوترهای شهرستان یزد نسبت به پرندگان وحشی بالاتر است، در هیچ کدام از نمونه‏ها‏ لیستریا مونوسیتوژنز و لیستریا ایوانوای یافت نشد. این مطالعه نشان داد که نمی‏توان کبوترهای این منطقه را به عنوان منبع یا حامل لیستریا مونوسیتوژنز و لیستریا ایوانوای تلقی نمود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Molecular detection of Listeria monocytogenes and Listeria ivanovii in pigeons in the city of Yazd, Iran

نویسندگان [English]

  • Abdolkarim Zamani Zamani Moghadam 1
  • Hossein Tahmasby 2
  • Hassan Momtaz 3
  • Naser Salehi 4
  • Samaneh Mehrabiyan 5
1 Associate Professor of Poultry Diseases and Hygiene, University of Shahrekord, Shahrekord, Iran
2 DVM Student, University of Shahrekord, Shahrekord, Iran
3 Associate Professor of Microbiology, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
4 DVM Student, University of Shahrekord, Shahrekord, Iran
5 DVM Student, University of Shahrekord, Shahrekord, Iran
چکیده [English]

Introduction: Birds can harbor human pathogens, including L. monocytogenes and L. ivanovii and transmit then to the humans. Due to many people's interests to keep pigeons, present study was conducted to determine the occurrence of L. monocytogenes and L. ivanovii from pigeon faeces in Yazd. Materials and Methods: In the present study, 150 samples of bird faeces were collected with sterile cotton swabs from different areas of the city of Yazd, Iran. Swabs were placed directly into Listeria enrichment broth. One ml of primary enrichments was transferred to 9 ml of Frazer broth. Secondly enrichments were streaked on Palcam agar. Then, they were evaluated for detection of L. monocytogenes and L. ivanovii by PCR method. Results: Although overall prevalence of Listeria species was 2% (3 out of 150), no L. monocytogenes and no L. ivanovii were found in our study. Discussion and Conclusion: The sources of Listeria spp. in birds are the foods they eat and the environments they live. Since nutritions, living environments, and hygiene level of pigeons are better than those of the wild birds, L. monocytogenes and L. ivanovii were not found in any samples. The present result is suggesting that pigeons are not the source or the carrier of L. monocytogenes and L. ivanovii in the region.

کلیدواژه‌ها [English]

  • Listeria
  • pigeon
  • PCR

مقدمه

مطالعات اپیدمیولوژیک در سراسر دنیا برای اطلاع از وضعیت میکروبی پدیده‏ها‏ی مختلف و خصوصا نقش آن‏ها‏ در انتقال عوامل بیماری‏زا‏ به انسان ضروری است. این مطالعات ‏می‏توانند منابع اطلاعاتی ارزشمندی را ‏برای‏ مبارزه با بیماری‏ها‏ی انسانی، یافتن منابع و منشأ، کنترل و یا ریشه کنی آن‏ها‏ فراهم آورند.

جنس لیستریا 6 گونه دارد، چهار گونه از آن، غیر بیماری‏زا‏ و دو گونه از آن، به نام‏ها‏ی لیستریا مونوسیتوژنز و لیستریا ایوانوای بیماری‏زا هستند. لیستریا مونوسیتوژنز به عنوان عامل سقط، انسفالیت، سپتی سمی در انسان و حیوانات شناخته شده است و لیستریا ایوانوای نیز به علت نقش در سقط، مرده زایی، و سپتی سمی جنینی، در عفونت‏ها‏ی گوسفند و گاو از اهمیت بالایی برخوردار است. همچنین، گاهی در انسان نیز ایجاد عفونت ‏می‏کند (1 و 2).

پرندگان ممکن است باکتری را از روده‏ها‏ی خود به زنجیره غذایی منتقل کنند. برای مثال، پرندگان به محیط‏ها‏ی فرآوری مواد غذایی وارد ‏می‏شوند و ‏می‏توانند سبزیجاتی را که در محیط‏ها‏ی باز رشد ‏می‏کنند یا غذاهایی را که در بازار آزاد فروخته ‏می‏شوند، آلوده نمایند (3). همچنین، پرندگان قفس و خانگی نیز به صورت بالقوه ‏می‏توانند میکروب‏ها‏ی بیماری‏زا‏ را در خود جای داده، به افرادی که با آن‏ها در تماس هستند، منتقل کنند (4).

مطالعات عمده‏ای‏ که در پرندگان گوناگون، از قبیل پرندگان زینتی مختلف، همچون کبوتر، مرغ عشق و قناری (5 و 6)، پرندگان وحشی در قفس (7) و پرندگان وحشی (3) از نظر آلودگی به گونه‏ها‏ی لیستریا در نقاط مختلف دنیا انجام شده است، نشان دهنده شیوع متفاوت لیستریا در مناطق مختلف بوده است. بنابراین، با توجه به این‏که‏‏ پرندگان ‏می‏توانند حامل لیستریا باشند، اطلاع از وضعیت آلودگی و نقش آن‏ها‏ در انتقال عوامل بیماری‏زا‏ به انسان، در پرندگان زینتی، بویژه کبوتر که علاقه زیادی نسبت به نگهداری ‏از آن وجود دارد، ضروری به نظر ‏می‏رسد.

با توجه به علاقه بسیاری از مردم در نگهداری‏ از کبوتر، همچنین امکان انتقال عوامل بیماری‏زا‏ از قبیل لیستریا توسط آن و اینکه‏‏ اطلاعات چندانی در مورد وضعیت آلودگی به عوامل بیماری‏زا‏، خصوصا لیستریا در پرندگان زینتی در کشور در دست نیست، نقش احتمالی کبوترها در انتشار و انتقال گونه‏ها‏ی بیماری‏زا‏ی لیستریا به انسان در این منطقه در هاله‏ای‏ از ابهام باقی مانده است. در این مطالعه به ارزیابی آلودگی به لیستریا مونوسیتوژنز و لیستریا ایوانوای در کبوترهای یزد به روش PCR پرداخته شده است.

 

مواد و روش‏ها‏

جمع آوری نمونه

این مطالعه در شهرستان یزد که منطقه‏ای‏ با آب و هوای گرم و خشک بیابانی است، صورت گرفت. در مجموع تعداد 150 نمونه مدفوعی از کبوترهای خانگی از 13 نقطه مختلف از شهرستان یزد در زمستان سال 1389 به وسیله سوآب استریل اخذ شد.

کشت و آزمایش‏های بیوشیمیایی

سوآب‏ها‏ مستقیما درون محیط کشت آبگوشت غنی کننده لیستریا[1] (مرک، ساخت آلمان) قرار گرفتند و در دمای 30 درجه سانتی‏گراد به مدت 72-48 ساعت انکوبه شدند. سپس یک میلی‏لیتر از محیط کشت مذکور به 9 میلی‏لیتر آبگوشت فریزر لیستریا[2] (هایمدیا، ساخت هندوستان) اضافه شد و به مدت 48-24 ساعت در دمای 30 درجه سانتیگراد ‏گرم‏خانه‏گذاری شد. پس از آن، نمونه‏ها‏ بر روی محیط پالکام آگار[3] (مرک، ساخت آلمان) کشت داده و به مدت 48 ساعت در دمای 37 درجه سانتی‏گراد‏ انکوبه شدند (8). کلنی‏ها‏ی کوچک، مورب و کمی محدب به عنوان پرگنه‏ها‏ی مشکوک به لیستریا مونوسیتوژنز و لیستریا ایوانوای ‏برای‏ تأیید از نظر رنگ آمیزی گرم، کاتالاز، حرکت، احیای نیترات، همولیز، آزمایش کمپ و تخمیر قندهایی چون رامنوز، گزیلوز، مانیتول آزمایش شدند (9). نمونه‏ها‏ی مشکوک به لیستریا مونوسیتوژنز و لیستریا ایوانوای تا زمان انجام PCR در محیط TSB (مرک، ساخت آلمان) گلیسیرین‏دار در دمای 20- درجه نگهداری ‏شدند.

 

PCR

کنترل مثبت لیستریا مونوسیتوژنز ATCC 19114 و لیستریا ایوانوای ATCC 19119 از مرکز کلکسیون قارچ‏ها‏ و باکتری‏ها‏ی صنعتی ایران تهیه شد. نمونه‏ها‏ی مشکوک ‏برای‏ جستجوی لیستریا مونوسیتوژنز و لیستریا ایوانوای پس از استخراج DNA با روش جوشاندن (10) به وسیله PCR با استفاده از پرایمرهای اختصاصی درج شده در جدول 1، که قبلا توسط چوی و هونگ [4]برای ردیابی اختصاصی لیستریا مونوسیتوژنز (11) ، لیو[5] و همکاران برای ردیابی اختصاصی لیستریا ایوانوای (12) و دومیث[6] و همکاران برای ردیابی اختصاصی جنس (هر 6 گونه) لیستریا به ثبت رسیده است (13)، مورد آزمون قرار گرفتند. واکنش PCR با استفاده از مواد تهیه شده از شرکت سیناژن در حجم 25 میکرولیتر (5/2 میکرولیتر بافر10X PCR ، 5/1 میکرولیتر MgCl2 50 میلی‏‏مولار، 75/0 میکرولیترdNTP 10 میلی‏‏مولار، 5/1 واحد آنزیم Taq پلی‏‏‏‏‏‏‏مراز، 1 میکرولیتر با غلظت 10 میکرومولار از هر پرایمر، 1 میکرولیتر DNA الگو) انجام شد. دماهای مورد استفاده در واکنش PCR در جدول 2 درج شده است. در پایان، محصولات PCR روی ژل آگاروز (سیناژن، ایران) 5/1 درصد با استفاده از نشانگر‏‏‏‏‏ 100 جفت بازی پلاس (فرمنتاس، ساخت آلمان) الکتروفورز شد.

 

 

جدول 1- مشخصات پرایمرهای به کار رفته ‏برای‏ جستجوی‏‏ اختصاصی جنس لیستریا (همه ی گونه‏ها‏ی لیستریالیستریا مونوسیتوژنز و لیستریا ایوانوای

نام گونه

نام ژن هدف

نام پرایمرها

توالی پرایمرها

منبع

اندازه محصول

لیستریا مونوسیتوژنز

listeriolysin O(hly)

DG69

DG74

F: GTGCCGCCAAGAAAAGGTTA

R: CGCCACACTTGAGATAT

(11)

636 bp

لیستریاایوانوای

N-acetylmuramidase-like protein gene

liv22-228 F

liv22-228 R

F: CGAATTCCTTATTCACTTGAGC

R: GGTGCTGCGAACTTAACTCA

(12)

436 bp

جنس لیستریا (همه ی گونه‏ها‏ی لیستریا)

phosphoribosyl pyrophosphate synthetase (prs)

Prs01

Prs02

F: GCTGAAGAGATTGCGAAAGAAG

R: CAAAGAAACCTTGGATTTGCGG

(13)

370 bp

 

 

 

 

جدول 2- برنامه‏ها‏ی دمایی به کار رفته ‏برای‏ جستجوی‏‏ اختصاصی جنس لیستریا (همه گونه‏ها‏ی لیستریالیستریا مونوسیتوژنز و لیستریا ایوانوای

(برای همه پرایمرها، واسرشت اولیه در 94 درجه سانتیگراد به مدت 5 دقیقه و گسترش نهایی در 72 درجه سانتیگراد به مدت 7 دقیقه انجام شد.)

نام گونه

واسرشت

دمای اتصال

گسترش

سیکل

لیستریا مونوسیتوژنز

94 درجه سانتیگراد

45 سیکل

55 درجه سانتیگراد

45 سیکل

72 درجه سانتیگراد

45 سیکل

30

لیستریا ایوانوای

94 درجه سانتیگراد

20 سیکل

60 درجه سانتیگراد

20 سیکل

72 درجه سانتیگراد

45 سیکل

30

جنس (همه ی گونه‏ها‏) لیستریا

94 درجه سانتیگراد

24 سیکل

53 درجه سانتیگراد

69 سیکل

72 درجه سانتیگراد

69 سیکل

35

 

 


نتایج

در این مطالعه گرچه شیوع جنس لیستریا در نمونه‏ها‏ی مدفوع کبوتر دو درصد (3 از 150) بود، اما خوشبختانه در هیچ کدام از نمونه‏ها‏ گونه‏ها‏ی بیماری‏زا‏ی لیستریا مونوسیتوژنز و لیستریا ایوانوای یافت نشد (شکل1). نتایج آزمایش‏های بیوشیمیایی نیز با نتایج حاصل از PCR مطابقت داشت و در هیچ کدام از نمونه‏ها‏ لیستریا مونوسیتوژنز و لیستریا ایوانوای یافت نشد و در نتایج آزمایش‏‏‏‏‏‏‏ها‏ی بیوشیمیایی از سه جدایه لیستریا، دو نمونه با عنوان لیستریا سیلیگری و یک نمونه با عنوان لیستریا گرایی شناسایی شد که هیچ کدام بیماری‏زا‏ نیستند.

 

 

 

شکل1-  تصویر الکتروفورز ژل آگاروز‏‏‏‏‏. A: جنس لیستریا (370 جفت باز)، B: لیستریا مونوسیتوژنز (636 جفت باز) و C: لیستریا ایوانوای (436 جفت باز). M: نشانگر‏‏‏‏‏100 جفت بازی پلاس، NC: کنترل منفی، PC1: کنترل مثبت لیستریا مونوسیتوژنز، PC2: کنترل مثبت لیستریا ایوانوای، 1 تا 3: جدایه‏ها‏ی مثبت برای جنس لیستریا.

 


بحث و نتیجه گیری

گزارش‏های متعددی در زمینه جداسازی لیستریا مونوسیتوژنز از پرندگان وجود دارد. وبر[vii] و همکاران شیوع لیستریا مونوسیتوژنز را در کبوتر خانگی 9/0 درصد گزارش دادند (5). در مطالعه دیگری علی رغم اینکه‏‏ 400 نمونه ارزیابی شد، نبود لیستریا مونوسیتوژنز در نمونه‏ها‏ی مدفوع کبوتر گزارش شد (14). همچنین، در مطالعه‏ای‏ که در سال 2012 در زمینه بررسی پرندگان زینتی یزد از نظر آلودگی به لیستریا مونوسیتوژنز و لیستریا ایوانوای با روش PCR انجام شد، در هیچ کدام از نمونه‏ها‏ لیستریا مونوسیتوژنز و لیستریا ایوانوای یافت نشد (6). شیوع لیستریا مونوسیتوژنز در پرندگان وحشی از وضعیت متفاوتی برخوردار است؛ به گونه‏ای که کالوری[viii] و همکاران لیستریا مونوسیتوژنز را به میزان دو درصد از پرندگان وحشی در قفس جداسازی نمودند (7) اما هلستروم[ix] و همکاران شیوع لیستریا مونوسیتوژنز را در پرندگان وحشی فنلاند 36 درصد گزارش کرده و اظهار کرده اند که شیوع این عامل بیماری‏زا در پرندگان وحشی که در اماکن دفع زباله شهر حضور دارند، نسبت به پرندگان وحشی شهری به میزان قابل توجهی بیشتر بوده است (3). مشابه با مطالعه پیشین، بوترفروی[x] و همکاران نشان دادند که 46 درصد از کلاغ‏ها‏ی شهری یکی و یا بیشتر از یکی از گونه‏ها‏ی لیستریا را در خود جای داده اند و از میان نمونه‏ها‏ی مورد ارزیابی 33 درصد به لیستریا مونوسیتوژنز آلوده بوده‏اند (15). در پرتغال 285 نمونه مدفوع از مرغان نوروزی بررسی شد. میزان شیوع جنس لیستریا و گونه لیستریا مونوسیتوژنز به ترتیب 8/9 درصد و 6 درصد گزارش شد (16). در پژوهشی که در کانادا بر روی مرغان نوروزی نوک گرد به عمل آمد، نشان داده شد که 5/9 درصد آن‏ها‏ به لیستریا مونوسیتوژنز آلوده بودند (17).

در این مطالعه اگرچه جنس لیستریا از دو درصد از نمونه‏ها‏ی مورد بررسی جداسازی شد، اما خوشبختانه هیچ کدام به عنوان گونه‏ها‏ی بیماری‏زا‏ی لیستریا مونوسیتوژنز و لیستریا ایوانوای شناسایی نشدند و همگی از گونه‏ها‏ی غیر بیماری‏زا‏ تشخیص داده شدند. از این جنبه، این مطالعه با مطالعه‏ای‏ که در سال 2012 در یزد انجام شد (6) و مطالعه کاسانوواس[xi] و همکاران در سال 1999 (14) تشابه دارد.

کبوترهای مورد بررسی عمدتا در اتاق‏ها‏ی کوچک و یا در قفس نگهداری ‏می‏شدند. به عنوان غذا عمدتا گندم به کبوترها داده ‏می‏شد و تغذیه آن‏ها‏ توسط انسان صورت ‏می‏گرفت. توضیح احتمالی برای نتیجه این مطالعه ‏می‏تواند این نکته باشد که منبع گونه‏ها‏ی لیستریا در پرندگان غذا و محیطی است که استفاده می‏کنند (3). از آنجایی که سطح بهداشتی، وضعیت تغذیه‏ و محیط زندگی کبوترهای یزد نسبت به پرندگان وحشی، در سطح بالاتری قرار دارد، احتمالا به این علت در هیچ کدام از نمونه‏ها‏ گونه‏ها‏ی بیماری‏زا‏ی لیستریا مونوسیتوژنز و لیستریا ایوانوای یافت نشد.

نتایج مطالعه حاضر نشان ‏می‏دهد که نمی‏توان کبوترهای این منطقه را به عنوان منبع یا حامل گونه‏ها‏ی بیماری‏زا‏ی لیستریا مونوسیتوژنز و لیستریا ایوانوای تلقی نمود.

 

تشکر و قدردانی

بدین‏وسیله از پژوهشکده بیماری‏ها‏ی مشترک انسان و دام و حوزه معاونت پژوهشی دانشگاه شهرکرد ‏برای‏ تامین منابع مالی این تحقیق تشکر و قدردانی می‏شود.



[1]- Listeria Enrichment Broth

[2]- Listeria Fraser Broth

[3]- Palcam Agar

[4]- Choi and Hong

[5]- Liu

[6]- Doumith

[vii]- Weber

[viii]- Kalorey

[ix]- Hellström

[x]- Bouttefroy

[xi]- Casanovas

 

References

(1) Elischerova K, Cupkava E, Urgeova E, Lysy J, Sesevikova A. Isolation of Listeria ivanovii in Slovakia. Czechoslovak Epidemiology Microbiology Immunology 1990; 39: 228–236.

(2) Cummins AI, Fielding A K and McLauchlin J. Listeria ivanovii infection in a patient with AIDS. Journal of Infection 1994; 28: 89–91.

(3) Hellström S, Kiviniemi K, Autio T and Korkeala H. Listeria monocytogenes is common in wild birds in Helsinki region and genotypes are frequently similar with those found along the food chain. Journal of Applied Microbiology 2008; 104: 883–888.

(4) Krauss H , Weber A, Appel M, Enders B, Isenberg HD, Schiefer HG, et al. Zoonoses: Infectious Diseases Transmissible From Animals to Humans, 3rd ed. Washington, DC: American Society for Microbiology Press; 2003.

(5) Weber A, Potel J and Schafer-Schmidt R. The occurrence of Listeria monocytogenes in faecal samples of pigeons. Berliner und Munchener Tierarztliche Wochenschrift 1995; 108: 26-7.

(6) Zamani Moghadam A, Tahmasby H, Salehi N. Evaluation of Listeria monocytogenes and Listeria ivanovii infection in cage birds in Yazd, Iran by polymerase chain reaction. Jentashapir 2012; 2(4): 213-218.

(7) Kalorey DR, Kurkure NV, Warke SR, Rawool DB, Malik SV, Barbuddhe SB. Isolation of pathogenic Listeria monocytogenes in faeces of wild animals in captivity. Comparative Immunology, Microbiology & Infectious Diseases 2006; 29: 295–300

(8) McClain D, Lee WH. Development of USDA-FSIS method for isolation of Listeria monocytogenes from raw meat and poultry. Journal of Association of Official Analytical Chemists 1988; 71: 660–4.

(9) Seeliger HPR, Jones D. Listeria. In: Sneath PHA, Maine NS, Sharpe ME, Holt JG (Eds.), Bergey's Manual of Systematic Bacteriology. Maryland: Williams & Wilkins, Baltimore; 1986: 1235–45.

(10) Gussow D, Clackson T. Direct clone characterization from plaques and colonies by the polymerase chain reaction. Nucleic Acids Research 1989; 17: 4000.

(11) Choi WS, Hong C . Rapid enumeration of Listeria monocytogenes in milk using competitive PCR. International Journal of Food Microbiology 2003; 84 : 79– 85

(12) Liu D, Ainsworth A J, Austin F W, Lawrence M L. PCR detection of a putative N-acetylmuramidase gene from Listeria ivanovii facilitates its rapid identification. Veterinary Microbiology 2004; 101: 83–9

(13) Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. Journal of Clinical Microbiology 2004; 42: 3819–22

(14) Casanovas L, de Simón M, Ferrer MD, Arqués J, Monzón G. Intestinal carriage of campylobacters, salmonellas, yersinias and Listerias in pigeons in the city of Barcelona. Journal of Applied Microbiology 1995; 78(1): 11–13

(15) Bouttefroy A, Lemaitre JP and Rousset A. Prevalence of Listeria sp. in droppings from urban rooks (Corvus frugilegus). Journal of Applied Microbiology 1997; 82: 641 -647

(16) Duartea E L, Guerra M M and Bernardo F M. Salmonella and Listeria spp. carriage by gulls (larids). Revista Portuguesa de Ciências Veterinárias 2002; 97(544): 181-187.

(17) Quessy S and Messier S. Prevalence of Salmonella spp., Campylobacter spp. and Listeria spp. in ring-billed gulls (Larus delawarensis). Journal of Wildlife Disease 1992; 28: 526-531.