جداسازی، شناسایی مولکولی Alcanivorax dieselolei ‏از خلیج فارس و بررسی قابلیت تجزیه زیستی آن برای پاک‏سازی آلودگی نفتی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار میکروبیولوژی، دانشگاه شهید باهنر کرمان، دانشکده علوم، گروه زیست شناسی، کرمان، ایران

2 استاد میکروبیولوژی، دانشگاه اصفهان، اصفهان، ایران

چکیده

مقدمه: آلودگی نفتی در محیط‏‏ها‏ی دریایی، مسأله‏ای جهانی است. میکروب‏ها‏ی تجزیه کننده هیدروکربن دریایی اجباری اخیراً شرح داده شده اند. یک عضو اصلی از این خانواده Alcanivorax بوده که در محیط‏ها‏‏ی دریایی پس از دو هفته از نشت نفت غالب می‏شود. مواد و روش‏ها‏: در این تحقیق، ابتدا از مناطق آلوده به نفت در خلیج فارس نمونه برداری شد. باکتری‏ها‏ در محیط ONR7a غنی سازی شدند و کلنی‏ها‏ روی محیط مارین اگار خالص‏سازی شدند. تمام کلنی‏ها‏ برای قابلیت تجزیه نفت خام غربال‏گری شدند. شناسایی مولکولی با تکثیر ژن 16S rDNA و تعین توالی انجام شد. نتایج: در مجموع 11 کلنی که قادر به تجزیه نفت خام بودند، جداسازی شدند. سویه‏ها‏ی PG-24 و PG-12 رشد بالاتری روی نفت خام نشان دادند. شناسایی مولکولی همسانی 99 درصد‏‏ با ‏Alcanivorax dieselolei از این دو سویه را نشان داد. این دو سویه قادر به رشد روی هیدروکربن‏ها‏ی الیفاتیک بودند و بالاترین رشد روی C16 و C18 مشاهده شد. تجزیه نفت خام به‏وسیله این دو سویه 85 درصد‏ پس از پنج روز بود. بحث و نتیجه گیری: این اولین گزارش از جداسازی جنسAlcanivorax در خلیج فارس است. مطالعه بیشتر این باکتری‏ها‏ و بهینه سازی تجزیه آلودگی‏ها‏ی نفتی می‏تواند نقش مهمی در تعدیل آلودگی نفتی خلیج فارس ایفا نماید.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation, and molecular detection of Alcanivorax dieselolei in the Persian Gulf and the study of biodegradation ability for remediation of oil pollution

نویسندگان [English]

  • Mehdi Hassanshahian 1
  • Giti Emtiazi 2
1 Assistant Professor of Microbiology, Department of Biology, Faculty of Science, Shahid Bahonar University of Kerman, Kerman, Iran,
2 Professor of Microbiology, University of Isfahan, Isfahan, Iran
چکیده [English]

Introduction: Oil pollution in marine environments is a global problem. The Persian Gulf is a specific region because over than 60 % of world crude oil transports through the strait of Hormoz. Obligate marine hydrocarbon-degrading microbes have been recently reported. Alcanivorax, a member of this family is predominant in oil polluted sea.Materials and Methods: In this survey, seawater samples were collected from oil contaminated regions in the Persian Gulf. Bacteria were enriched in ONR7a medium and colonies were purified in marine agar and ONR7a media. All colonies were screened for ability to degrade crude oil. Molecular identification was carried out by amplification of 16S rDNA gene and sequencing analysis. Also, biodegradation of some hydrocarbon and crude oil were analyzed. Results: Totally, eleven different colonies were isolated that were able to degrade crude oil. Two strains (PG-24 and PG-12) showed higher growth rates on crude oil than other strains. Molecular identification showed 99% homology of these two strains with Alcanivorax dieselolei. These two strains could grow on aliphatic hydrocarbon and the highest growth rates were observed on C16 and C18 substrates, also 80 % of crude oil was degraded. Discussion and Conclusion: This article is the first report on isolation of Alcanivorax genus from the Persian Gulf, thereby further studies and optimization of biodegradation of oil pollution by these bacteria are important for modulate oil pollution in the Persian Gulf.

کلیدواژه‌ها [English]

  • Biodegradation
  • Alcanivorax
  • Optimization
  • Oil pollution
  • Persian Gulf

مقدمه

هیدروکربن‏ها‏ی نفتی ذخایر انر‍ژی مهمی هستند که کاربرد‏ها‏ی زیادی در صنعت و حتی در زندگی روزانه ما دارند. در عین حال، نفت منشأ آلودگی مهم محیط است. متعاقب رهاسازی نفت در محیط، تبدیل آن به ترکیبات سازنده خیلی سریع شروع می‏شود. روش‏ها‏ی مرسوم برای جلوگیری از نشت نفت عمدتاً روش‏ها‏ی فیزیکی شیمیایی هستند که عبارتند از: استفاده از مواد منعقد کننده، رویه برداری و غیره. روش‏ها‏ی زیستی دارای مزایایی نسبت به روش‏ها‏ی فیزیکی و شیمیایی در حذف نشت نفت هستند؛ به‏طوری‏که آن‏ها‏ تجزیه زیستی درونی بخش‏ها‏ی نفت به‏وسیله میکروارگانیسم‏ها‏ را میسر می‏سازند. (‏‏1، 2 و3)‏‏.

تجزیه زیستی مشتقات نفتی در محیط‏ها‏ی آلوده مؤثرتر، قوی‏تر و از نظر اقتصادی مقرون به صرفه‏تر از روش‏ها‏ی فیزیکی شیمیایی است. میزان تجزیه زیستی وابسته به غلظت، طول آلکان‏ها، بیوسورفکتانت و نوع میکروارگانیسم است. ترکیبات اشباع نفت خام و بویژه آلکان‏ها‏ی با طول زنجیره متوسط، سریع‏تر تجزیه می‏شوند (‏‏4)‏‏. میزان تجزیه و معدنی شدن ترکیبات آلی وابسته به غلظت ترکیبات است، به‏طوری‏که غلظت بالایی از هیدروکربن به‏وسیله محدود کردن مواد غذایی و اکسیژن یا از طریق تأثیرات سمی ایجاد شده به‏وسیله هیدروکربن‏ها‏ی فرار از تجزیه زیستی ممانعت می‏کند. رشد میکروارگانیسم‏ها‏ روی هیدروکربن‏ها‏ اغلب با ‏انحلال منابع کربن نامحلول در محیط کشت همراه است و در بیشتر موارد، با تولید عوامل انحلال کننده خارج سلولی در طی شکست هیدروکربن‏ها‏ همراه است. این فرایندها به رشد میکروارگانیسم روی نفت خام و شکست آن به اجزای کوچک‏تر کمک می‏کند (‏‏5 و 6)‏‏.

 طی چند سال اخیر، تلاش‏ها‏یی برای جداکردن میکروب‏ها‏ی دریایی با کشت آب دریا بر روی سوبستراهای هیدروکربنی صورت گرفته و باکتری‏ها‏ی جدیدی از بیشتر نواحی جهان جدا شده است. چنین باکتری‏ها‏یی الیگوتروف‏ها‏ی کند رشد هستند و از نظر ماده غذایی مورد مصرف، محدود بوده، تنها قادر به استفاده از هیدروکربن‏ها‏ی نفتی به عنوان منبع کربن و انرژی هستند.این باکتری‏ها‏ را باکتری‌های دریایی تجزیه کننده نفت اجباری یا هیدروکربنوکلاستیکوس می‏نامند که نقش مهمی در حذف بیولوژیک هیدروکربن‌های نفتی از آب‌های دریای آلوده دارند. ‏Alcanivoraxborkumensisدر سال 1998 از رسوبات دریای شمال که در مرز هلند- آلمان واقع است، جدا شد (‏‏7)‏‏. Borkum جزیره کوچکی است که در بندر Elms درنزدیکی دریای شمال واقع است. بعدها این باکتری در بسیاری از نواحی ساحلی و دریایی جهان، مثل دریای مدیترانه، اقیانوس آرام، دریای ژاپن و چین نیز مشاهده شد.A. borkumensisیک باکتری دریازی است که قادر به رشد بر روی طیف محدودی از سویستراهاست، که عمدتاً سوبسترای آن آلکان‏ها‏ هستند ‏(‏‏8)‏‏.

هدف از این تحقیق، بررسی وجود جنسAlcanivoraxدر خلیج فارس و جداسازی آن است. پس از جداسازی، هدف این است که قابلیت تجزیه زیستی آن ‏برای حذف و پاک‏سازی آلاینده‏ها‏ی نفتی سنجیده شود.

 

مواد و روش‏ها‏

نمونه برداری

به منظور جداسازی باکتری‏ها‏ی تجزیه کننده نفت خام، رسوبات آلوده و نمونه‏ها‏ی آب دریا از خلیج فارس جمع آوری شد. نمونه‏ها‏ی رسوبات از عمق ‏1 تا 12 سا‏نتی‏متر سطح ساحل با استفاده از چاقوی استریل به‏دست آمد. نمونه‏ها‏ی آب دریا از عمق ‏15 سا‏نتی‏متر در بطری‏ها‏ی 100 میلی‏‏لیتری جمع آوری شد و روی یخ به آزمایشگاه منتقل شد(‏‏9)‏‏.

جداسازی Alcanivorax ‏از آب و رسوبات دریا

برای جداسازی جنس Alcanivorax میزان100 میلی‏لیتر از آب دریا و پنج گرم از رسوبات با 3 میلی‏لیتر ‏از نفت خام ‏همراه با 55/. گرم از گرانولر نیتروژن ‏و 1/. گرم از گرانولر فسفات در محیط ONR مخلوط شد. ارلن‏ها‏ روی شیکر با دور ‏rpm60 و دمای 15 درجه سانتیگراد به مدت یک ماه انکوبه شدند. پس از یک ماه میزان یک میلی‏‏لیتر از این محیط به محیط ‏ONR جدید منتقل شده، پس از دو پاساژ متوالی کلنی‏ها‏ روی محیط مارین آگار (MA ) خالص سازی شدند. ترکیبات محیط ONR در یک لیتر به شرح زیر است: به‏علت ایجاد رسوب باید اینمحیط در دو محلول جداگانه ساخته شود و پس از اتوکلاو با همدیگر مخلوط شوند. منبع کربن محیط نفت با غلظت (یک درصد) است. محلول اول شامل: NaCl (23 گرم)، Na2SO4 ( 8/3 گرم)، KCl (72/0)، NaBr (83 ‏میلی‏‏گرم)، NaHCO3 (31 ‏میلی‏‏گرم.)،H3BO3(27 ‏میلی‏‏گرم)، NaF (6/2 ‏میلی‏‏گرم)، NH4Cl (27/. گرم)، Na2HPO4 (89 ‏میلی‏‏گرم) محلول دوم شامل: MgCl2(18/11 گرم)، CaCl2 (46/1 گرم)، SrCl2 (24 میلی‏‏گرم)، FeCl2(2 میلی‏‏گرم)، TAPSO (3/1 گرم). اسیدیته‏ محیط برابر با 6/7 تنظیم شد (‏‏10)‏‏.

شناسایی Alcanivorax

کلنی‏ها‏ی جداسازی شده بر روی محیط مارین آگار ابتدا با روش‏ها‏ی بیوشیمیایی غربال‏گری اولیه شدند. آزمایش‏های بیوشیمیایی که برای شناسایی این جنس استفاده شدند، عبارتند از: رنگ آمیزی گرم، آزمایش‏ احیای نیترات، اکسیداز، هیدرولیز نشاسته و ژلاتین و آزمایش‏ استفاده از قند‏ها‏یی از جمله مانیتول، مانوز و ساکاروز.

کلنی‏ها‏ی غربال‏گری شده با روش مولکولی مورد ‏شناسایی دقیق‏تر قرار گرفتند. بدین منظور، ابتدا استخراج DNA از باکتری‏ها‏ با استفاده از کیت شرکت کیاژن طبق دستورالعمل کیت انجام شد. ‏سپس واکنش PCR با استفاده از پرایمرهای ویژه ژن 16SrDNA انجام گردید. توالی این پرایمرها عبارت است از: پرایمر برگشتی Uni_1492R-TACGYTACCTTGTTACGACTT-

و پرایمر رفت

Bac27_F-AGAGTTTGATCCTGGCTCAG- 

واکنش PCR در حجم 25 میکرولیتر صورت گرفت. غلظت مواد مصرف شده در PCR شامل بافر PCR ‏(TrismM20و mM KCl 50 )، MgCl2(mM2)، پرایمر رفتی و برگشتی µM 12/0، آنزیم Taq (U 1)، dNTP(µM200) و DNA الگو میزان 30 نانوگرم بود. برنامه PCR ‏شامل دمای دناتوراسیون 94 درجه سانتیگراد به مدت یک دقیقه، دمای اتصال پرایمرها 55 درجه سانتیگراد به مدت یک دقیقه و دمای تکثیر 72 درجه سانتیگراد به مدت یک دقیقه و تعداد سیکل‏ها‏ 35 است. محصول حاصل از PCR در ژل آگاروز 1 درصد بارگذاری شد و سپس باند ‏bp1400 ‏از ژل آگاروز طبق دستورالعمل کیت فرمنتاز (K0513) استخراج و برای تعیین توالی فرستاده شد. نتایج حاصل از تعیین توالی در بانک‏ها‏ی ژنی بلاست[1] شده، همولوژی آن‏ها‏ بررسی شد و قرابت بالاتر از 98 درصد به‏عنوان جنس و گونه باکتری مجهول لحاظ شد (‏‏11)‏‏.

سنجش رشد و حذف نفت خام

منحنی رشد ایزوله‏ها‏ به‏طور غیر‏مستقیم با اندازه‏گیری کدورت در 600 نانومتر با اسپکتروفتومتری سنجش شد. میزان حذف نفت خام به‏وسیله حل کردن مقدار نفت باقیمانده ‏محیط کشت در دی کلرومتان و سپس خواندن کدورت نفت استخراج شده در مقابل شاهد در طول موج 420 نانومتر تعیین شد (‏‏12)‏‏. هر یک از آزمایش‏های دارای سه تکرار بوده اند و اعداد گزارش شده میانگین سه عدد هستند.

سنجش میزان تجزیه نفت با روش گاز کروماتوگرافی

قبل از آغاز آزمایش و تلقیح باکتری‏ها‏ به محیط نفت براث میزان 1/. میلی‏گرم بر میلی‏لیتر‏ازNonano‏EptaMetil ‏به‏عنوان استاندارد درونی به نفت خام اضافه شد. در انتهای دوره انکوباسیون (7 روز) میزان ‏50 ‏میلی‏لیتر دی کلرو متان[2] (DCM) به ارلن حاوی کشت باکتری و نفت اضافه گردید. DCM ‏بخوبی با محیط نفت براث مخلوط شد و درون قیف جداکننده ریخته شد تا دو فاز آلی و آبی از هم جدا شوند. سپس فاز آلی که حاوی نفت حل شده در DCM بود، درون ارلن ریخته و سه گرم سدیم سولفات برای جذب آب باقیمانده به ارلن اضافه گردید و به مدت یک شب در دمای اتاق انکوبه شد. سپس محتویات ارلن از کاغذ واتمن شماره 2 عبور داده شد و درون تبخیر کننده گردشی برای تبخیر DCM قرار گرفت. پس از تبخیر DCM میزان ‏10‏ میلی‏لیتر هگزان نرمال به نفت اضافه شد و توسط دستگاه GC ( در کشور ایتالیا) تحلیل شد. برنامه GC بدین صورت بود:ستون: Hewlett Packard RonaFused‏ ‏Silica Capillary (30 m × 0.32 mm × 0.25 mm) ، دتکتور: FID، گاز حامل: هلیم، دمای اولیه:

 100 درجه سانتیگراد برای سه دقیقه، دمای انتقال: 300درجه سانتیگراد، دمای تزریق: 330 درجه سانتیگراد، دمای نگهداری ستون: 240 درجه سانتیگراد برای 50 دقیقه، دمای نهایی: 320 درجه سانتیگراد و جریان عبوری 7/. میلی‏لیتر بر دقیقه، پیک‏ها‏ی حاصل از GC با استاندارد درونی مقایسه شد و درصد تجزیه برای هر سویه محاسبه شد (‏‏13 و 14)‏‏.

 

نتایج

جداسازی و غربال‏گری باکتری‏ها‏ی تجزیه‏کننده نفت خام

25 ‏سویه باکتریایی تجزیه‏کننده نفت خام از رسوبات و آب خلیج فارس جداسازی شد. در بین آن‏ها‏ چهار کلنی که به خصوصیات باکتری Alcanivorax شباهت زیادی داشتند، ‏برای مطالعات بعدی انتخاب شدند. این چهار کلنی شامل سویه‏ها‏ی PG-12, PG-11, PG-24 و PG-31 بودند. خصوصیات مورفولوژیک و بیوشیمیایی این چهار سویه در جدول 1 آمده است. همه این سویه‏ها‏ گرم منفی، میله‏ای، با قابلیت بالای رشد در غلظت نمک بالا، اکسیداز مثبت و احیای نیترات مثبت بودند. شباهت بیوشیمایی دو سویه PG-24 ‏و PG-12 به همدیگر بیشتر ازPG-11و PG-31 ‏بود.

 

 

جدول1- نتیجه تست های بیوشیمیاییبرای سویه های  PG-12, PG-11, PG-31, PG-24

PG-12

PG-11

PG-31

PG-24

نوع تست بیوشیمیایی

Negative

Negative

Negative

Negative

Gram Staining

Rod

Rod

Rod

Rod

Morphology

+

+

+

-

Growth at 4°C

-

-

-

+

Growth at 45°C

3–5

3–8

3–8

3–6

Optimal NaCl  (%)

15

32.5

32.5

20

Maximal NaCl (%)

+

+

+

+

Nitrate reduced to nitrite

+

+

+

+

Oxidase test

-

-

-

-

Arginine dihydrolase

-

+

+

-

Ornithine decarboxylase

-

-

-

-

Gelatin liquefaction

-

-

-

-

Starch hydrolysis

-

+

+

-

Lysine decarboxylase

-

+

+

-

Urease activity

-

+

+

-

Utilization as sole carbon source:

-

+

+

-

L-Alanine

-

+

+

-

L-Arginine

-

+

+

-

Aspartate

-

+

+

-

D-Glucose

-

+

+

-

L-Glutamate

-

+

+

-

Glycerol

-

+

+

+

Hexadecane

-

+

+

-

d-Mannitol

+

+

+

+

d-Mannose

-

-

-

-

Succinate

+

-

-

-

Sucrose

 

 

 


شناسایی مولکولی جنس Alcanivorax

شناسایی مولکولی سویه‏ها‏ی انتخاب شده در غربال‏گری بیوشیمیایی با تکثیر قسمتی از ناحیه ژنی16S rDNAبا پرایمرهای ویژه این ژن انجام شد. سپس محصول bp 1400 حاصل از PCRاز ژل استخراج، خالص‏سازی و تعیین توالی شد. توالی حاصله در بانک‏ها‏ی ژنی بلاست شد و بالاترین همولوژی ( بالاتر از 98 درصد‏‏) به‏عنوان جنس و گونه باکتری تعیین شد. نتایج حاصل از شناسایی مولکولی با توالی حاصل در جدول 2 آمده است. همان‏طور که در جدول دیده می‏شود، دو سویه PG-24‏و PG-12 ‏به‏عنوان Alcanivorax dieselolei از بین چهار سویه انتخابی شناسایی شدند. فیلوژنی و قرابت این دو سویه در شکل 1 آمده است.


جدول 2- شناسایی مولکولی سویه های جداسازی شده

درصد شباهت

شماره دستیابی

شناسایی سویه

توالی

نام سویه

99

FM957534

Alcanivoraxdieselolei

Strain PG-12

TACACACGTGCTACAATGGcTAGTACAGAGGGT

TGCGAAGTCGCGACGCGGAGCTATCTCTTAA

GCCAATCGTAGTCCGGATTGGAGTCTGCAA

CTCGACTCCATGAAGTCGGAATCGCTAGTAATCG

CGGATCAGAATGCCGCGGTGAATACGTTCCCGGG

CCTTGTACACACCGCCCGTCACaCCATGGG

AGTGGAGGgaCACCAGAAGTccTTAGTGTAAC

PG-12

 

98

FM957534

Alcanivoraxdieselolei

Strain PG-24

TGGTGCTTTCCACTCCCATGGTGTGACGGGCGGT

GTGTACAAGGCCCGGCAACGTATTCACCGTG

ACATTCTGATTCACGATTACTAGCGATTCCGAC

TTCACGGAGTCTAGTTGCAGACTCCGATCCGG

ACTGAGACCGGGCTTTATGAAATTTAGCTCCAC

CTTGGGGGTTGCCACCCTTGTACTAGCCATCG

GACACAGGTTGCAGGAGTGGGGA

PG-24

 

 

شکل1- ‏فیلوژنی سویه‏ها‏ی باکتریایی جداسازی شده در مقایسه نزدیکی آن‏ها‏ با سویه استاندارد.

 

 

این درخت با استفاده از توالی‏ها‏ی مناطق قابل مقایسه منطقه ژنی 16S rRNA موجود در بانک ژنی ساخته شده است. مقیاس نشان داده شده بیانگر تفرق توالی‏ها‏ است. اطلاعات توالی موقعیت ‏ A. dieselolei PG-12 ‏وA. dieselolei PG-24 را نشان می‏دهد.

رشد و حذف نفت خام به‏وسیله ایزوله‏ها‏

هر چهار سویه بر روی غلظت‏ها‏ی (یک درصد‏) نفت خام رشد داده شدند. پس از یک هفته میزان رشد و حذف نفت خام به‏وسیله سویه‏ها‏ به روش اسپکتروفتومتری سنجش شد. نتایج حاصله در جدول 3 آمده است. سویه‏ها‏ی PG-24 ‏و PG-12 قابلیت رشد و حذف نفت بالاتری نسبت به سویه‏ها‏ی PG-11 و PG-31 ‏داشتند.

جدول 3- میزان رشد و حذف نفت خام بوسیله سویه های جداسازی شده

میزان حذف نفت

میزان رشد ( جذب نوری در 600 نانومتر)

نام سویه

52 درصد

54/.

PG-11

71 درصد

7/.

PG-12

61 درصد

4/.

PG-31

68 درصد

482/

PG-24

نتایج حاصل از میزان حذف نفت خام به‏وسیله دو سویه Alcanivorax dieseloleiجداسازی شده با روش گاز کروماتوگرافی

برای اینکه معین شد که چه بخشی از نفت به‏وسیله هر سویه مصرف شده است و چه ترکیباتی کاهش بیشتری پس از دوره انکوباسیون تجزیه زیستی داشته‏اند، تحلیل گاز کروماتوگرافی ‏از نفت باقیمانده در محیط کشت برای هر سویه انجام شد. نتایج حاصله در شکل 2 آمده است. همان‏طور که در این شکل دیده می‏شود، سویه A. dieselolei PG-12 قابلیت حذف نفت بیشتری نسبت به سویه ‏A. dieselolei PG-24 دارد و طیف گاز کروماتوگرافی نیز نسبت به شاهد کاهش بیشتری داده است.

 

 

شکل 2- ‏طیف‏ها‏ی گاز کروماتوگرافی حاصله از تجزیه زیستی نفت خام به‏وسیله دو سویهA. dieseloleiجداسازی شده . نمونه (A): شاهد بدون حضور باکتری تجزیه کننده ‏نمونه (B): A. dieselolei PG-24‏ نمونه (C): درصد تجزیه هر یک از آلکان‏ها‏ حاضر در نفت خام توسط سویه‏ها‏ی A. dieselolei

 

با محاسبه سطح زیر منحنی از طیف‏ها‏ی گاز کروماتوگرافی حاصل شده برای هر سویه و کسر نمودن هر پیک آلکانی از استاندارد درونی (EptaMetilNonano) درصد تجزیه هر یک از آلکان‏ها‏ حاضر در نفت خام توسط سویه‏ها‏ی تجزیه کننده به‏دست آمد. نتایج در جدول 4 نشان داده شده است. اعداد موجود در جدول درصد تجزیه هر یک از آلکان‏ها‏ را بر حسب سویه بازگو می‏کند. همان‏طور که در این جدول دیده می‏شود، با افزایش عدد کربن آلکان میزان تجزیه کاهش یافته است و از طرف دیگر، سویه A. dieseloleiPG-12 قابلیت حذف آلکان‏ها‏ را به‏صورت بهتری نسبت به سویه ‏A. dieseloleiPG-24 دارد.

 

جدول4- درصد تجزیه آلکان‏ها‏ی موجود در نفت خام به ‏وسیله دو سویه Alcanivorax جداسازی شده

باکتری‏ها‏ به مدت یک هفته در محیط ‏ONR7a در دمای 30 درجه و با سرعت همزنی ‏RPM 150 انکوبه شدند. میزان تجزیه آلکان‏ها‏ با روش گاز کروماتوگرافی تعین شد.

سویه  PG-12

سویه  PG-24

کنترل

آلکان

سویه

100

100

20

C9

100

100

22

C10

100

100

18

C11

100

100

20

C12

100

100

17

C13

100

100

15

C14

100

100

10

C15

100

100

7

C16

79

64

6

C17

77

60

0

C18

79

54

0

C19

68

42

0

C20

62

51

0

C21

60

41

0

C22

55

40

0

C23

43

38

0

C24

40

35

0

C25

 

بحث و نتیجه‏گیری

میلیون‏ها‏ لیتر نفت از منابع طبیعی و ساخت دست بشر هر ساله وارد محیط می‏شوند. ورودی از تراوش نفت به محیط دریایی به تنهایی کافی است که همه اقیانوس‏ها‏ی جهان را با لایه ای به ضخامت 20 مولکول نفت بپوشاند. باکتری‏ها‏ی تجزیه کننده هیدروکربن‏ها‏ی نفتی حدود یک قرن قبل جداسازی شدند. در بازنگری اخیر 79 جنس باکتریایی شناخته شده‏اند که می‏توانند از هیدروکربن‏ها‏ به‏عنوان منبع کربن و انرژی استفاده کنند. همین‏طور 9 سیانوباکتری، 103 قارچ و 14 جنس جلبک یافت شده‏اند که قادر به تجزیه هیدروکربن‏ها‏ هستند (‏‏15)‏‏. پژوهشگران متعددی باکتری‏ها‏ی تجزیه کننده نفت خام را از محیط‏ها‏ی گوناگون اعم از محیط‏ها‏ی خشکی و دریایی جداسازی نمودند. از جمله اکوسیستم‏ها‏ی خشکی می‏توان به تحقیق ‏ایجاه[iii] اشاره کرد(‏‏16)‏‏. آن‏ها‏ در تحقیق خود 20 باکتری تجزیه کننده نفت خام و 10 سویه مخمری را از خاک‏ها‏ی آلوده به نفت در نیجریه جداسازی نمودند. تحقیق آن‏ها‏ اثبات‏کرد که میکروارگانیسم‏ها‏ی تجزیه کننده محدود به خاک‏ها‏ی آلوده به نفت نیستند ‏(‏‏16)‏‏.

مثال دیگر از محیط‏ها‏ی خشکی مربوط به تحقیق چایلان[iv] و همکاران است. این محققان از خاک‏ها‏ی آلوده به نفت و توده سیانوباکتری در اندونزی تعداد 8 باکتری، 21 قارچ و 4 مخمر تجزیه کننده نفت جداسازی نمودند. جنس‏ها‏ی باکتریایی جدا شده عمدتاً متعلق به جنس‏ها‏ی Gordonia, Brevibacterium, Burkholderia و Mycobacterium و جنس‏ها‏ی مخمری شامل Candida, Yarrowia و Pichia بودند ‏(‏‏17)‏‏.

علی‏رغم فراوانی هیدروکربن‏ها‏ در سیستم‏ها‏ی دریایی که از نشت نفت و تخلیه گاز طبیعی و از حوادث اشتعال نفت در دریا نشأت می‏گیرد، باکتری‏ها‏ی تجزیه کننده هیدروکربن‏ها‏ی دریایی به میزان کمی بررسی شده‏اند (‏‏17)‏‏. در این‏جا به ‏برخی تحقیقات که بر روی محیط‏ها‏ی دریایی انجام شده است، اشاره می‏شود.

روی[v] و همکارانباکتری‏ها‏ی تجزیه کننده نفت را در آب‏ها‏ی ساحلی منطقه Sunderban هند شرح دادند ‏(‏‏18)‏‏. سنجش‏ها‏ی باکتریولوژیک روی نمونه‏ها‏ی آب سطحی از این منطقه نشان داد که دو درصد از ‏باکتری‏ها‏ی هتروتروف قابل کشت در روی محیط مارین آگار قادر به استفاده از هیدروکربن‏ها‏ به‏عنوان تنها منبع کربن و انرژی هستند. آن‏ها‏ در تحقیق خود 7 سویه باکتریایی از این محیط دریایی جداسازی نمودند که به جنس‏ها‏ی Pseudomonas, Mycobacterium, Acinetobacter, Micrococcus, Nocardia تعلق داشتند (‏‏18)‏‏.

برخلاف تجزیه کننده‏ها‏ی هیدروکربن خشکی زی که از نظر متابولیکی ‏قوی بوده، دامنه سوبسترایی وسیعی را نشان می‏دهند، تجزیه کننده‏ها‏ی دریازی، به‏ویژه نوع شورپسند (HCB) بسیار اختصاصی بوده، به‌شکل اجباری تنها از هیدروکربن‏ها‏ استفاده می‏کنند (‏‏18)‏‏. مفهوم باکتری‏ها‏ی HCB ابتدا به‏وسیله ‏یاکیمو[vi] و همکاران با جداسازیA. borkumensisاز جزیره Borkum ‏آلمان ارایه شد ‏(7). پس از شرح این باکتری گونه‏ها‏ی دیگری ‏از آن در سایر نقاط جهان شرح داده شدند و مشخص شد که باکتری Alcanivoraxیک باکتری جهانی است. جنس‏ها‏ی دیگری از باکتری‏ها‏ی HCB در سال‏ها‏ی بعد شرح داده شدند، به‏طوری‏که گلیشین[vii] و همکاران جنس Oleiphilus ( از لنگرگاه مسینا، ایتالیا)، ‏‏مرکوز[viii] و همکارانجنس M. hydrocarbonoclasticus ( از منطقه نفتی دریایی جنوب ویتنام) و یاکیمو و همکاران ‏‏جنس Thalassolituus را از منطقه نفتی میلازو ‏(ایتالیا) جداسازی نمودند ‏(‏‏19، 20 و 21)‏‏.

در تحقیق حاضر، چهار سویه باکتری شور‏پسند تجزیه کننده نفت (HCB) از خلیج فار س جداسازی شد که دو سویه در جنس Alcanivorax قرار گرفتند. این سویه‏ها‏ قادر به تجزیه نفت خام، تنها در حضور NaCl بودند که با خصوصیات شرح داده شده برای باکتری‏ها‏ی HCB به‏وسیله سایر محققان همخوانی دارد.

گونه باکتری Alcanivorax جداسازی شده در این تحقیق پس از تعیین توالی مشخص شد که متعلق به A. dieselolei است. این اولین گزارش از جداسازی جنس Alcanivorax در خلیج فارس و ایران است. این گونه ابتدا به‏وسیله لیو[ix] ‏و همکاران شرح داده شد. این محققان باکتری A. dieselolei را از آب‏ها‏ی آلوده به نفت دریای Bohai چین جداسازی نمودند (‏‏22).



[1] . BLAST

[2]. Dichloromethane

[iii] . Ijah

[iv] . Chaillan

[v] . Roy

[vi] . Yakimov

[vii] . Golyshin

[viii] . Merquez

[ix] . Liu

References

(1) Ijah UJJ. Studies on relative capabilities of bacterial and yeast isolates from tropical soil in degrading crude oil. Waste Manage1998; 18(5): 293–9.

(2).Luis Y, Mara E, Corbella M, Turie¨gano UK, Antonio P, Fernando R. Characterization of bacterial strains able to grow on high molecular mass residues from crude oil processing. FEMS Microbio Ecol 2000, 32(1): 69-75.

(3). Vinas M, Grifoll M, Sabate J, Solanas A. Biodegradation of a crude oil by three microbial consortia of different origins and metabolic capabilities. J Indus Microbiol & Biotech 2002; 28(5): 252 –60.

(4). Hanson KG, Anuranjini N, Madhavi K, Anjana JD. Bioremediation of crude oil contamination with Acinetobacter sp A3. Curr Microbiol 1997; 35(3): 191–193.
 

(5).Burns KA, Codi S, Swannell RJP, Duke NC. Assessing the oil degradation potential of endogenous microorganisms in tropical marine wetlands. Mangr Salt Marsh 1999; 3, 67-83.

(6).Manee P, Prayad P, Edward S, Upatham A, Ladda T. Biodegradation of crude oil by soil microorganisms in the tropic. Biodeg 1998; 9: 83–90.

(7).Yakimov M, Peter N, Siegmund L. Alcanivorax borkumensis gen. nov., sp. nov., a new, hydrocarbon-degrading and surfactant- producing marine bacterium. Inter J System Bacteriol 1998; 48: 339–48.

(8) Yakimov MM, Golyshin PN, Timmis KN.Obligate oil-degrading marine bacteria. Curr Opin Biotech 2007; 18(3): 257-66.

(9) Hasanshahian M, Emtiazi G. Investigation of alkane bipdegradation using the microtiter plate method and correlation between biofilm formation, biosurfactant production and crude oil biodegradation. Int Biodeter Biodegr 2008; 62(2): 170-178.

(10). Hasanshahian M, Emtiazi G. Cappello S. Isolation and characterization of crude-oil-degrading bacteria from the Persian Gulf and the Caspian Sea. Mar Pollut Bull 2012a; 64(1): 7–12.

(11).Hassanshahian M, Emtiazi G, Kermanshahi R, Cappello S. Comparison of oil degrading microbial communities in sediments from the Persian Gulf and Caspian Sea. Soil Sediment Contam 2010 19(3): 277-91.

(12).Emtiazi G, Hassanshahian M, Golbang N. Development of a microtiter plate method for determination of phenol utilization, biofilm formation and respiratory activity by environmental bacterial isolates. Int Biodeter Biodegr 2005; 56: 231-5.

(13) Emtiazi G, Saleh T, Hassanshahian M. The effect of bacterial glutathione S-transferase on morpholine degradation. Biotech J 2009 ; 4: 202–5.

(14) Ghanavati H, Emtiazi G, Hassanshahian M. Synergism effects of phenol degrading yeast and Ammonia Oxidizing Bacteria for nitrification in coke wastewater of Esfahan Steel Company. Waste Manage Res2008; 26(2): 203-8.

(15).Head IM, Jones DM, Roling WFM. Marine microorganisms make a meal of oil. Natu Rev Microbio 2006; 4(3): 173–182.

(16).Watanabe K, Hamamura N. Molecular and physiological approaches to understanding the ecology of pollutant degradation. CurrOpin Biotech 2003; 14(3): 289-95.

(17).Chaillan F, Le FA, Bury E, Phantavong YH, Grimont P, Saliot A, Oudot j. Identification and biodegradation potential of tropical aerobic hydrocarbon-degrading microorganisms. Res Microbio 2004; 155(7): 587-95.

(18).Roy S, Dipak H, Debabrata B, Dipa B, Ranajit K. Survey of petroleum-degrading bacteria in coastal waters of sunderban biosphere reserve World J Microbio Biotechno 2002; 18: 575–581.

(19).Golyshin P, Tatiana N, Chernikova W, Abraham H, Timmis K, Yakimov MM. Oleiphilaceae fam. nov., to include Oleiphilus messinensis gen. nov., sp. nov., a novel marine bacterium that obligately utilizes hydrocarbons. Inte J System Evol Microbio 2002; 52: 901–911.

(20).Marquez MC, Ventosa A. Marinobacter hydrocarbonoclasticus Gauthier et al. 1992 and Marinobacter aquaeolei Nguyen et al. 1999 are heterotypic synonyms. Inter J System Evol Microbio 2005; 55: 1349–51.

(21) Yakimov MM, Giuliano L, Denaro R, Crisafi E, Chernikova T, Abraham W, Timmis K, Golyshin, P. Thalassolituus oleivorans gen. nov., sp. nov., a novel marine bacterium that obligatory utilizes hydrocarbons. Inter J System Evol Microbio 2004; 54: 141–8.

(22) Liu C, Zongze S. Alcanivorax dieselolei sp. nov., a novel alkane-degrading bacterium isolated from sea water and deep-sea sediment. Inter J System Evol Microbio 2005; 55: 1181–86.